EMAIL THIS PAGE TO A FRIEND

MLF1IP

MLF1 interacting protein

88 Gene Product Result for
Synonyms: CENP50 CENPU CENPU50 KLIP1 PBIP1
UniProtKB ID: Q71F23, A2RRD9, Q32Q71, Q9H5G1
Gene ID:
Human(79682) Summary: The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). MLF1IP, or CENPU, is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]
Mouse(71876) myeloid leukemia factor 1 interacting protein
Rat(306464) MLF1 interacting protein
naked mole-rat(101704226) MLF1 interacting protein
domestic guinea pig(100718024) MLF1 interacting protein
sheep(101108985) MLF1 interacting protein
chicken(422548) MLF1 interacting protein
domestic cat(101095819) MLF1 interacting protein
cow(617866) MLF1 interacting protein
dog(607799) MLF1 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024629 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024629 Rosetta Predictions human pricing
NM_001025673 Rosetta Predictions rat pricing
NM_027973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175574 predicted 1394
2 SASI_Hs02_00357010 predicted 1379
3 SASI_Hs01_00175575 predicted 1194
4 SASI_Hs01_00175576 predicted 1417
5 SASI_Hs01_00175578 predicted 661
6 SASI_Hs01_00175579 predicted 1367
7 SASI_Hs01_00175580 predicted 449
8 SASI_Hs01_00175581 predicted 1020
9 SASI_Hs01_00175582 predicted 765
10 SASI_Hs01_00175583 predicted 803
11 SASI_Hs01_00175577 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104207 predicted 1019
2 SASI_Rn01_00104208 predicted 396
3 SASI_Rn01_00104210 predicted 1064
4 SASI_Rn01_00104211 predicted 888
5 SASI_Rn01_00104212 predicted 456
6 SASI_Rn01_00104213 predicted 1124
7 SASI_Rn01_00104214 predicted 1000
8 SASI_Rn01_00104215 predicted 1186
9 SASI_Rn01_00104216 predicted 990
10 SASI_Rn02_00203265 predicted 504
11 SASI_Rn01_00104209 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033873 predicted 782
2 SASI_Mm01_00033874 predicted 852
3 SASI_Mm01_00033876 predicted 741
4 SASI_Mm01_00033877 predicted 977
5 SASI_Mm01_00033878 predicted 1132
6 SASI_Mm01_00033879 predicted 908
7 SASI_Mm01_00033880 predicted 814
8 SASI_Mm01_00033881 predicted 1168
9 SASI_Mm01_00033882 predicted 1109
10 SASI_Mm02_00333011 predicted 1024
11 SASI_Mm01_00033875 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024629
VALIDATED
MLF1IP MISSION shRNA Bacterial Glycerol Stock
MLF1 interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024629.3-122s21c1
Sequence:CCGGAGACGTTCAAAGAACACTTTACTCGAGTAAAGTGTTCTTTGAACGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024629.3-1186s21c1
Sequence:CCGGAGCTCAAGAACCAAACGTAAACTCGAGTTTACGTTTGGTTCTTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024629.3-810s21c1
Sequence:CCGGACATCAAGGAGTTGAATATTGCTCGAGCAATATTCAACTCCTTGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024629.3-1646s21c1
Sequence:CCGGAGGCGATTTCTCCTGAATTTACTCGAGTAAATTCAGGAGAAATCGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024629.2-1579s1c1
Sequence:CCGGCCCAGGTATGAGCTATAATAACTCGAGTTATTATAGCTCATACCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-1119s1c1
Sequence:CCGGCCCTTAGGAATGCAGCATATTCTCGAGAATATGCTGCATTCCTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-290s1c1
Sequence:CCGGCCTTTACATAGCACAGCTATACTCGAGTATAGCTGTGCTATGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-492s1c1
Sequence:CCGGGCATTGAAGAAAGTGATACAACTCGAGTTGTATCACTTTCTTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-1282s1c1
Sequence:CCGGGCGAAATATCAACCATCAGTTCTCGAGAACTGATGGTTGATATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024629
VALIDATED
MLF1IP MISSION shRNA shRNA Plasmid DNA
MLF1 interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024629.3-122s21c1
Sequence:CCGGAGACGTTCAAAGAACACTTTACTCGAGTAAAGTGTTCTTTGAACGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024629.3-1186s21c1
Sequence:CCGGAGCTCAAGAACCAAACGTAAACTCGAGTTTACGTTTGGTTCTTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024629.3-810s21c1
Sequence:CCGGACATCAAGGAGTTGAATATTGCTCGAGCAATATTCAACTCCTTGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024629.3-1646s21c1
Sequence:CCGGAGGCGATTTCTCCTGAATTTACTCGAGTAAATTCAGGAGAAATCGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024629.2-1579s1c1
Sequence:CCGGCCCAGGTATGAGCTATAATAACTCGAGTTATTATAGCTCATACCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-1119s1c1
Sequence:CCGGCCCTTAGGAATGCAGCATATTCTCGAGAATATGCTGCATTCCTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-290s1c1
Sequence:CCGGCCTTTACATAGCACAGCTATACTCGAGTATAGCTGTGCTATGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-492s1c1
Sequence:CCGGGCATTGAAGAAAGTGATACAACTCGAGTTGTATCACTTTCTTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-1282s1c1
Sequence:CCGGGCGAAATATCAACCATCAGTTCTCGAGAACTGATGGTTGATATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024629
VALIDATED
MLF1IP MISSION shRNA Lentiviral Transduction Particles
MLF1 interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024629.3-122s21c1
Sequence:CCGGAGACGTTCAAAGAACACTTTACTCGAGTAAAGTGTTCTTTGAACGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024629.3-1186s21c1
Sequence:CCGGAGCTCAAGAACCAAACGTAAACTCGAGTTTACGTTTGGTTCTTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024629.3-810s21c1
Sequence:CCGGACATCAAGGAGTTGAATATTGCTCGAGCAATATTCAACTCCTTGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024629.3-1646s21c1
Sequence:CCGGAGGCGATTTCTCCTGAATTTACTCGAGTAAATTCAGGAGAAATCGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072643    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024629.2-1579s1c1
Sequence:CCGGCCCAGGTATGAGCTATAATAACTCGAGTTATTATAGCTCATACCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-1119s1c1
Sequence:CCGGCCCTTAGGAATGCAGCATATTCTCGAGAATATGCTGCATTCCTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-290s1c1
Sequence:CCGGCCTTTACATAGCACAGCTATACTCGAGTATAGCTGTGCTATGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-492s1c1
Sequence:CCGGGCATTGAAGAAAGTGATACAACTCGAGTTGTATCACTTTCTTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024629.2-1282s1c1
Sequence:CCGGGCGAAATATCAACCATCAGTTCTCGAGAACTGATGGTTGATATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027973
VALIDATED
MLF1IP MISSION shRNA Bacterial Glycerol Stock
MLF1 interacting protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.3-964s1c1
Sequence:CCGGCAGGATGAACTGATTCGATTACTCGAGTAATCGAATCAGTTCATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.3-735s1c1
Sequence:CCGGCATAACGGAGTTGGATGTTATCTCGAGATAACATCCAACTCCGTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027973.3-2105s1c1
Sequence:CCGGCGTTGAGTTAAGGTATGAAATCTCGAGATTTCATACCTTAACTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.2-1128s1c1
Sequence:CCGGGAACGGGAAAGTATGATTCATCTCGAGATGAATCATACTTTCCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-76s1c1
Sequence:CCGGGAACACTTTGAGAAGCACATACTCGAGTATGTGCTTCTCAAAGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-798s1c1
Sequence:CCGGGAGTAGAATCTGAAAGTTGTACTCGAGTACAACTTTCAGATTCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-781s1c1
Sequence:CCGGCCTGGAGTATAAGCAAAGAGTCTCGAGACTCTTTGCTTATACTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-1131s1c1
Sequence:CCGGCGGGAAAGTATGATTCATCTACTCGAGTAGATGAATCATACTTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.2-850s1c1
Sequence:CCGGGAAAGGAGAACTCATCAGAATCTCGAGATTCTGATGAGTTCTCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027973
VALIDATED
MLF1IP MISSION shRNA shRNA Plasmid DNA
MLF1 interacting protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.3-964s1c1
Sequence:CCGGCAGGATGAACTGATTCGATTACTCGAGTAATCGAATCAGTTCATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.3-735s1c1
Sequence:CCGGCATAACGGAGTTGGATGTTATCTCGAGATAACATCCAACTCCGTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027973.3-2105s1c1
Sequence:CCGGCGTTGAGTTAAGGTATGAAATCTCGAGATTTCATACCTTAACTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.2-1128s1c1
Sequence:CCGGGAACGGGAAAGTATGATTCATCTCGAGATGAATCATACTTTCCCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-76s1c1
Sequence:CCGGGAACACTTTGAGAAGCACATACTCGAGTATGTGCTTCTCAAAGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-798s1c1
Sequence:CCGGGAGTAGAATCTGAAAGTTGTACTCGAGTACAACTTTCAGATTCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-781s1c1
Sequence:CCGGCCTGGAGTATAAGCAAAGAGTCTCGAGACTCTTTGCTTATACTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-1131s1c1
Sequence:CCGGCGGGAAAGTATGATTCATCTACTCGAGTAGATGAATCATACTTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.2-850s1c1
Sequence:CCGGGAAAGGAGAACTCATCAGAATCTCGAGATTCTGATGAGTTCTCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027973
VALIDATED
MLF1IP MISSION shRNA Lentiviral Transduction Particles
MLF1 interacting protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.3-964s1c1
Sequence:CCGGCAGGATGAACTGATTCGATTACTCGAGTAATCGAATCAGTTCATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.3-735s1c1
Sequence:CCGGCATAACGGAGTTGGATGTTATCTCGAGATAACATCCAACTCCGTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027973.3-2105s1c1
Sequence:CCGGCGTTGAGTTAAGGTATGAAATCTCGAGATTTCATACCTTAACTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.2-1128s1c1
Sequence:CCGGGAACGGGAAAGTATGATTCATCTCGAGATGAATCATACTTTCCCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-76s1c1
Sequence:CCGGGAACACTTTGAGAAGCACATACTCGAGTATGTGCTTCTCAAAGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-798s1c1
Sequence:CCGGGAGTAGAATCTGAAAGTTGTACTCGAGTACAACTTTCAGATTCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-781s1c1
Sequence:CCGGCCTGGAGTATAAGCAAAGAGTCTCGAGACTCTTTGCTTATACTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027973.2-1131s1c1
Sequence:CCGGCGGGAAAGTATGATTCATCTACTCGAGTAGATGAATCATACTTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027973.2-850s1c1
Sequence:CCGGGAAAGGAGAACTCATCAGAATCTCGAGATTCTGATGAGTTCTCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)