EMAIL THIS PAGE TO A FRIEND

MLF2

myeloid leukemia factor 2

70 Gene Product Result for
Synonyms: NTN4
UniProtKB ID: Q15773
Gene ID:
Mouse(30853) myeloid leukemia factor 2
Rat(312709) myeloid leukemia factor 2
Zebrafish(561675) myeloid leukemia factor 2
cow(513843) myeloid leukemia factor 2
domestic cat(101084292) myeloid leukemia factor 2
dog(486721) myeloid leukemia factor 2
chicken(418284) myeloid leukemia factor 2
sheep(101110749) myeloid leukemia factor 2
domestic guinea pig(100725976) myeloid leukemia factor 2
naked mole-rat(101714981) myeloid leukemia factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005439 Rosetta Predictions human pricing
NM_001107889 Rosetta Predictions rat pricing
NM_145385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028275 predicted 265
2 SASI_Hs01_00028276 predicted 912
3 SASI_Hs01_00028277 predicted 392
4 SASI_Hs01_00028278 predicted 750
5 SASI_Hs01_00028279 predicted 236
6 SASI_Hs01_00028280 predicted 511
7 SASI_Hs01_00028281 predicted 423
8 SASI_Hs01_00028282 predicted 244
9 SASI_Hs01_00028283 predicted 470
10 SASI_Hs01_00028284 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233275 predicted 659
2 SASI_Rn02_00233276 predicted 294
3 SASI_Rn02_00233277 predicted 550
4 SASI_Rn02_00233278 predicted 311
5 SASI_Rn02_00233279 predicted 802
6 SASI_Rn02_00233280 predicted 469
7 SASI_Rn02_00233281 predicted 356
8 SASI_Rn02_00233282 predicted 423
9 SASI_Rn02_00233283 predicted 593
10 SASI_Rn02_00233284 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052359 predicted 252
2 SASI_Mm01_00052360 predicted 938
3 SASI_Mm01_00052361 predicted 850
4 SASI_Mm02_00340704 predicted 563
5 SASI_Mm01_00052362 predicted 356
6 SASI_Mm01_00052363 predicted 965
7 SASI_Mm01_00052364 predicted 938
8 SASI_Mm01_00052365 predicted 223
9 SASI_Mm01_00052366 predicted 450
10 SASI_Mm01_00052367 predicted 313
11 SASI_Mm01_00052368 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005439
VALIDATED
MLF2 MISSION shRNA Bacterial Glycerol Stock
myeloid leukemia factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005439.2-990s21c2
Sequence:CCGGCCTTCTTTAATCTCCTGGTTTCTCGAGAAACCAGGAGATTAAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005439.1-278s1c1
Sequence:CCGGCGTATGTTGTCAGGTGGCTTTCTCGAGAAAGCCACCTGACAACATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005439.1-451s1c1
Sequence:CCGGGATTGGAAACATGGAACACATCTCGAGATGTGTTCCATGTTTCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005439.2-300s21c2
Sequence:CCGGGTTTGGGATGATGAATGACATCTCGAGATGTCATTCATCATCCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005439.1-496s1c1
Sequence:CCGGCTTCTCATCTTCCACTGTCATCTCGAGATGACAGTGGAAGATGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005439.1-1119s1c1
Sequence:CCGGCCTTCTTTAATCTCCTGGTTTCTCGAGAAACCAGGAGATTAAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005439.1-430s1c1
Sequence:CCGGGTTTGGGATGATGAATGACATCTCGAGATGTCATTCATCATCCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005439.2-321s21c2
Sequence:CCGGGATTGGAAACATGGAACACATCTCGAGATGTGTTCCATGTTTCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005439.2-366s21c2
Sequence:CCGGCTTCTCATCTTCCACTGTCATCTCGAGATGACAGTGGAAGATGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005439
VALIDATED
MLF2 MISSION shRNA shRNA Plasmid DNA
myeloid leukemia factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005439.2-990s21c2
Sequence:CCGGCCTTCTTTAATCTCCTGGTTTCTCGAGAAACCAGGAGATTAAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005439.1-278s1c1
Sequence:CCGGCGTATGTTGTCAGGTGGCTTTCTCGAGAAAGCCACCTGACAACATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005439.1-451s1c1
Sequence:CCGGGATTGGAAACATGGAACACATCTCGAGATGTGTTCCATGTTTCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005439.2-300s21c2
Sequence:CCGGGTTTGGGATGATGAATGACATCTCGAGATGTCATTCATCATCCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005439.1-496s1c1
Sequence:CCGGCTTCTCATCTTCCACTGTCATCTCGAGATGACAGTGGAAGATGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005439.1-1119s1c1
Sequence:CCGGCCTTCTTTAATCTCCTGGTTTCTCGAGAAACCAGGAGATTAAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005439.1-430s1c1
Sequence:CCGGGTTTGGGATGATGAATGACATCTCGAGATGTCATTCATCATCCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005439.2-321s21c2
Sequence:CCGGGATTGGAAACATGGAACACATCTCGAGATGTGTTCCATGTTTCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005439.2-366s21c2
Sequence:CCGGCTTCTCATCTTCCACTGTCATCTCGAGATGACAGTGGAAGATGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005439
VALIDATED
MLF2 MISSION shRNA Lentiviral Transduction Particles
myeloid leukemia factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005439.2-990s21c2
Sequence:CCGGCCTTCTTTAATCTCCTGGTTTCTCGAGAAACCAGGAGATTAAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005439.1-278s1c1
Sequence:CCGGCGTATGTTGTCAGGTGGCTTTCTCGAGAAAGCCACCTGACAACATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005439.1-451s1c1
Sequence:CCGGGATTGGAAACATGGAACACATCTCGAGATGTGTTCCATGTTTCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005439.2-300s21c2
Sequence:CCGGGTTTGGGATGATGAATGACATCTCGAGATGTCATTCATCATCCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005439.1-496s1c1
Sequence:CCGGCTTCTCATCTTCCACTGTCATCTCGAGATGACAGTGGAAGATGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146966    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005439.1-1119s1c1
Sequence:CCGGCCTTCTTTAATCTCCTGGTTTCTCGAGAAACCAGGAGATTAAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005439.1-430s1c1
Sequence:CCGGGTTTGGGATGATGAATGACATCTCGAGATGTCATTCATCATCCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005439.2-321s21c2
Sequence:CCGGGATTGGAAACATGGAACACATCTCGAGATGTGTTCCATGTTTCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005439.2-366s21c2
Sequence:CCGGCTTCTCATCTTCCACTGTCATCTCGAGATGACAGTGGAAGATGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145385
MLF2 MISSION shRNA Bacterial Glycerol Stock
myeloid leukemia factor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145385.2-527s21c1
Sequence:CCGGCTTCTCCTCCTCCACTGTTATCTCGAGATAACAGTGGAGGAGGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145385.2-1065s21c1
Sequence:CCGGCCAACCTCTATCCCAATTTAACTCGAGTTAAATTGGGATAGAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-384s1c1
Sequence:CCGGGAACGACATGATCGGGAACATCTCGAGATGTTCCCGATCATGTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145385.2-676s21c1
Sequence:CCGGTGTCCATTGGGCATCACATTCCTCGAGGAATGTGATGCCCAATGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-372s1c1
Sequence:CCGGGTTTGGGATGATGAACGACATCTCGAGATGTCGTTCATCATCCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-673s1c1
Sequence:CCGGGACTACATCAACCTGGATGAACTCGAGTTCATCCAGGTTGATGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145385.2-320s21c1
Sequence:CCGGGTCAGGCGGCTTTGGATATAGCTCGAGCTATATCCAAAGCCGCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-700s1c1
Sequence:CCGGGCAGCAGCATTTGATGATGAACTCGAGTTCATCATCAAATGCTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145385.1-943s1c1
Sequence:CCGGGCTGAGTAACCATCCTTGAAACTCGAGTTTCAAGGATGGTTACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145385
MLF2 MISSION shRNA shRNA Plasmid DNA
myeloid leukemia factor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145385.2-527s21c1
Sequence:CCGGCTTCTCCTCCTCCACTGTTATCTCGAGATAACAGTGGAGGAGGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145385.2-1065s21c1
Sequence:CCGGCCAACCTCTATCCCAATTTAACTCGAGTTAAATTGGGATAGAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-384s1c1
Sequence:CCGGGAACGACATGATCGGGAACATCTCGAGATGTTCCCGATCATGTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145385.2-676s21c1
Sequence:CCGGTGTCCATTGGGCATCACATTCCTCGAGGAATGTGATGCCCAATGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-372s1c1
Sequence:CCGGGTTTGGGATGATGAACGACATCTCGAGATGTCGTTCATCATCCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-673s1c1
Sequence:CCGGGACTACATCAACCTGGATGAACTCGAGTTCATCCAGGTTGATGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145385.2-320s21c1
Sequence:CCGGGTCAGGCGGCTTTGGATATAGCTCGAGCTATATCCAAAGCCGCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-700s1c1
Sequence:CCGGGCAGCAGCATTTGATGATGAACTCGAGTTCATCATCAAATGCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145385.1-943s1c1
Sequence:CCGGGCTGAGTAACCATCCTTGAAACTCGAGTTTCAAGGATGGTTACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145385
MLF2 MISSION shRNA Lentiviral Transduction Particles
myeloid leukemia factor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145385.2-527s21c1
Sequence:CCGGCTTCTCCTCCTCCACTGTTATCTCGAGATAACAGTGGAGGAGGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145385.2-1065s21c1
Sequence:CCGGCCAACCTCTATCCCAATTTAACTCGAGTTAAATTGGGATAGAGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-384s1c1
Sequence:CCGGGAACGACATGATCGGGAACATCTCGAGATGTTCCCGATCATGTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145385.2-676s21c1
Sequence:CCGGTGTCCATTGGGCATCACATTCCTCGAGGAATGTGATGCCCAATGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-372s1c1
Sequence:CCGGGTTTGGGATGATGAACGACATCTCGAGATGTCGTTCATCATCCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-673s1c1
Sequence:CCGGGACTACATCAACCTGGATGAACTCGAGTTCATCCAGGTTGATGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145385.2-320s21c1
Sequence:CCGGGTCAGGCGGCTTTGGATATAGCTCGAGCTATATCCAAAGCCGCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145385.1-700s1c1
Sequence:CCGGGCAGCAGCATTTGATGATGAACTCGAGTTCATCATCAAATGCTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145385.1-943s1c1
Sequence:CCGGGCTGAGTAACCATCCTTGAAACTCGAGTTTCAAGGATGGTTACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)