EMAIL THIS PAGE TO A FRIEND

MLH1

mutL homolog 1

72 Gene Product Result for
Synonyms: COCA2 FCC2 HNPCC HNPCC2 hMLH1
UniProtKB ID: P40692, B4DI13, B4DQ11, E9PCU2
Gene ID:
Human(4292) Summary: This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]
Mouse(17350) mutL homolog 1 (E. coli)
Rat(81685) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
Zebrafish(393632) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
domestic cat(101089037) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
cow(533652) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
Horse(100050351) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
dog(477019) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
chicken(420729) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
Thale Cress(826493) DNA mismatch repair protein MLH1
fruit fly(35796) CG11482 gene product from transcript CG11482-RB
naked mole-rat(101698546) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
Domestic Rabbit(100337912) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
domestic guinea pig(100717848) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
sheep(101108344) mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M8445 Anti-MLH1 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunoprecipitation (IP) pricing
M8320 Anti-MLH1 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunocytochemistry, immunoprecipitation (IP), western blot pricing
HPA052707 Anti-MLH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501881 Anti-MLH1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
HPA060714 Anti-MLH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2104053 Anti-MLH1, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rabbit, human, dog, rat, horse, guinea pig
western blot pricing
WH0004292M2 Monoclonal Anti-MLH1 antibody produced in mouse clone M1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
SAB5300249 Monoclonal Anti-MLH1 antibody produced in mouse clone 4C9C7, ascites fluid human, monkey
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0004 Rabbit anti-MLH1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000249 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000249 siRNAs that have been validated in the lab human pricing
NM_031053 Rosetta Predictions rat pricing
NM_026810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000249 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000004 validated 195
1 SASI_WI_00000006 validated 1880
1 SASI_WI_00000005 validated 653
2 SASI_Hs01_00020261 predicted 1882
3 SASI_Hs01_00020262 predicted 1860
4 SASI_Hs01_00020264 predicted 588
5 SASI_Hs01_00020266 predicted 1064
6 SASI_Hs01_00020267 predicted 1705
7 SASI_Hs01_00020268 predicted 1684
8 SASI_Hs01_00020269 predicted 1332
9 SASI_Hs01_00020270 predicted 805
10 SASI_Hs02_00302169 predicted 2084
11 SASI_Hs02_00302170 predicted 837
12 SASI_Hs01_00020263 predicted 1304
13 SASI_Hs01_00020265 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264278 predicted 197
2 SASI_Rn01_00068132 predicted 211
3 SASI_Rn01_00068135 predicted 831
4 SASI_Rn01_00068136 predicted 1553
5 SASI_Rn01_00068137 predicted 996
6 SASI_Rn01_00068138 predicted 1094
7 SASI_Rn01_00068139 predicted 927
8 SASI_Rn02_00264279 predicted 478
9 SASI_Rn01_00068140 predicted 1654
10 SASI_Rn02_00264280 predicted 374
11 SASI_Rn01_00068131 predicted 1867
12 SASI_Rn01_00068133 predicted 1123
13 SASI_Rn01_00068134 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169745 predicted 534
2 SASI_Mm01_00169746 predicted 1865
3 SASI_Mm01_00169747 predicted 561
4 SASI_Mm01_00169748 predicted 297
5 SASI_Mm01_00169749 predicted 599
6 SASI_Mm01_00169750 predicted 2297
7 SASI_Mm01_00169751 predicted 205
8 SASI_Mm01_00169753 predicted 1719
9 SASI_Mm01_00169754 predicted 2073
10 SASI_Mm02_00330942 predicted 2281
11 SASI_Mm01_00169752 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000249
VALIDATED
MLH1 MISSION shRNA Bacterial Glycerol Stock
mutL homolog 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-2358s21c1
Sequence:CCGGGTGTTCTTCTTTCTCTGTATTCTCGAGAATACAGAGAAAGAAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-2298s21c1
Sequence:CCGGGCCTGATCTATACAAAGTCTTCTCGAGAAGACTTTGTATAGATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-565s21c1
Sequence:CCGGCCAAGTGAAGAATATGGGAAACTCGAGTTTCCCATATTCTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-2085s21c1
Sequence:CCGGCCTCAGTAAAGAATGCGCTATCTCGAGATAGCGCATTCTTTACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-2085s1c1
Sequence:CCGGCCTCAGTAAAGAATGCGCTATCTCGAGATAGCGCATTCTTTACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-565s1c1
Sequence:CCGGCCAAGTGAAGAATATGGGAAACTCGAGTTTCCCATATTCTTCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-2298s1c1
Sequence:CCGGGCCTGATCTATACAAAGTCTTCTCGAGAAGACTTTGTATAGATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-2358s1c1
Sequence:CCGGGTGTTCTTCTTTCTCTGTATTCTCGAGAATACAGAGAAAGAAGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.x-189s1c1
Sequence:CCGGAAGTTGATTCAGATCCAAGACTCGAGTCTTGGATCTGAATCAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.x-2071s1c1
Sequence:CCGGTATTCCATCCGGAAGCAGTACCTCGAGGTACTGCTTCCGGATGGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000249
VALIDATED
MLH1 MISSION shRNA shRNA Plasmid DNA
mutL homolog 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-2358s21c1
Sequence:CCGGGTGTTCTTCTTTCTCTGTATTCTCGAGAATACAGAGAAAGAAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-2298s21c1
Sequence:CCGGGCCTGATCTATACAAAGTCTTCTCGAGAAGACTTTGTATAGATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-565s21c1
Sequence:CCGGCCAAGTGAAGAATATGGGAAACTCGAGTTTCCCATATTCTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-2085s21c1
Sequence:CCGGCCTCAGTAAAGAATGCGCTATCTCGAGATAGCGCATTCTTTACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-2085s1c1
Sequence:CCGGCCTCAGTAAAGAATGCGCTATCTCGAGATAGCGCATTCTTTACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-565s1c1
Sequence:CCGGCCAAGTGAAGAATATGGGAAACTCGAGTTTCCCATATTCTTCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-2298s1c1
Sequence:CCGGGCCTGATCTATACAAAGTCTTCTCGAGAAGACTTTGTATAGATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-2358s1c1
Sequence:CCGGGTGTTCTTCTTTCTCTGTATTCTCGAGAATACAGAGAAAGAAGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.x-189s1c1
Sequence:CCGGAAGTTGATTCAGATCCAAGACTCGAGTCTTGGATCTGAATCAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.x-2071s1c1
Sequence:CCGGTATTCCATCCGGAAGCAGTACCTCGAGGTACTGCTTCCGGATGGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000249
VALIDATED
MLH1 MISSION shRNA Lentiviral Transduction Particles
mutL homolog 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-2358s21c1
Sequence:CCGGGTGTTCTTCTTTCTCTGTATTCTCGAGAATACAGAGAAAGAAGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-2298s21c1
Sequence:CCGGGCCTGATCTATACAAAGTCTTCTCGAGAAGACTTTGTATAGATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-565s21c1
Sequence:CCGGCCAAGTGAAGAATATGGGAAACTCGAGTTTCCCATATTCTTCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000249.2-2085s21c1
Sequence:CCGGCCTCAGTAAAGAATGCGCTATCTCGAGATAGCGCATTCTTTACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-2085s1c1
Sequence:CCGGCCTCAGTAAAGAATGCGCTATCTCGAGATAGCGCATTCTTTACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-565s1c1
Sequence:CCGGCCAAGTGAAGAATATGGGAAACTCGAGTTTCCCATATTCTTCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-2298s1c1
Sequence:CCGGGCCTGATCTATACAAAGTCTTCTCGAGAAGACTTTGTATAGATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.2-2358s1c1
Sequence:CCGGGTGTTCTTCTTTCTCTGTATTCTCGAGAATACAGAGAAAGAAGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.x-189s1c1
Sequence:CCGGAAGTTGATTCAGATCCAAGACTCGAGTCTTGGATCTGAATCAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000249.x-2071s1c1
Sequence:CCGGTATTCCATCCGGAAGCAGTACCTCGAGGTACTGCTTCCGGATGGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026810
VALIDATED
MLH1 MISSION shRNA Bacterial Glycerol Stock
mutL homolog 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026810.1-580s1c1
Sequence:CCGGGCAGGTATTCAATACACAATTCTCGAGAATTGTGTATTGAATACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026810.1-1872s1c1
Sequence:CCGGGCAGAGTACATTGTCGAGTTTCTCGAGAAACTCGACAATGTACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026810.1-2241s1c1
Sequence:CCGGCCGAAGCATTTCACAGAAGATCTCGAGATCTTCTGTGAAATGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026810.1-2201s1c1
Sequence:CCGGGCACATTATCTATAAAGCCTTCTCGAGAAGGCTTTATAGATAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026810.1-209s1c1
Sequence:CCGGGCTAATTCAGATCCAAGACAACTCGAGTTGTCTTGGATCTGAATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026810
VALIDATED
MLH1 MISSION shRNA shRNA Plasmid DNA
mutL homolog 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026810.1-580s1c1
Sequence:CCGGGCAGGTATTCAATACACAATTCTCGAGAATTGTGTATTGAATACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026810.1-1872s1c1
Sequence:CCGGGCAGAGTACATTGTCGAGTTTCTCGAGAAACTCGACAATGTACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026810.1-2241s1c1
Sequence:CCGGCCGAAGCATTTCACAGAAGATCTCGAGATCTTCTGTGAAATGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026810.1-2201s1c1
Sequence:CCGGGCACATTATCTATAAAGCCTTCTCGAGAAGGCTTTATAGATAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026810.1-209s1c1
Sequence:CCGGGCTAATTCAGATCCAAGACAACTCGAGTTGTCTTGGATCTGAATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026810
VALIDATED
MLH1 MISSION shRNA Lentiviral Transduction Particles
mutL homolog 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026810.1-580s1c1
Sequence:CCGGGCAGGTATTCAATACACAATTCTCGAGAATTGTGTATTGAATACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026810.1-1872s1c1
Sequence:CCGGGCAGAGTACATTGTCGAGTTTCTCGAGAAACTCGACAATGTACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026810.1-2241s1c1
Sequence:CCGGCCGAAGCATTTCACAGAAGATCTCGAGATCTTCTGTGAAATGCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026810.1-2201s1c1
Sequence:CCGGGCACATTATCTATAAAGCCTTCTCGAGAAGGCTTTATAGATAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026810.1-209s1c1
Sequence:CCGGGCTAATTCAGATCCAAGACAACTCGAGTTGTCTTGGATCTGAATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)