EMAIL THIS PAGE TO A FRIEND

MLH3

mutL homolog 3

128 Gene Product Result for
Synonyms: HNPCC7
UniProtKB ID: Q9UHC1, P49751, Q56DK9, Q9P292, Q9UHC0
Gene ID:
Human(27030) Summary: This gene is a member of the MutL-homolog (MLH) family of DNA mismatch repair (MMR) genes. MLH genes are implicated in maintaining genomic integrity during DNA replication and after meiotic recombination. The protein encoded by this gene functions as a heterodimer with other family members. Somatic mutations in this gene frequently occur in tumors exhibiting microsatellite instability, and germline mutations have been linked to hereditary nonpolyposis colorectal cancer type 7 (HNPCC7). Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Jul 2008]
Mouse(217716) mutL homolog 3 (E coli)
Rat(314320) mutL homolog 3 (E. coli)
sheep(101109183) mutL homolog 3 (E. coli)
domestic guinea pig(100735009) mutL homolog 3 (E. coli)
Domestic Rabbit(100339094) mutL homolog 3 (E. coli)
naked mole-rat(101723287) mutL homolog 3 (E. coli)
Zebrafish(568323) mutL homolog 3 (E. coli)
chicken(100859200) mutL homolog 3 (E. coli)
cow(786279) mutL homolog 3 (E. coli)
Horse(100057292) mutL homolog 3 (E. coli)
domestic cat(101096575) mutL homolog 3 (E. coli)
dog(480389) mutL homolog 3 (E. coli)
Thale Cress(829704) DNA mismatch repair protein MLH3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014381 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175337 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175337 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175337 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040108 Rosetta Predictions human pricing
NM_014381 Rosetta Predictions human pricing
NM_001108043 Rosetta Predictions rat pricing
NM_175337 Rosetta Predictions mouse pricing
XM_900622 Rosetta Predictions mouse pricing
XM_900639 Rosetta Predictions mouse pricing
XM_900643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021984 predicted 2591
2 SASI_Hs01_00021985 predicted 434
3 SASI_Hs01_00021986 predicted 1691
4 SASI_Hs02_00308832 predicted 3230
5 SASI_Hs01_00021987 predicted 2706
6 SASI_Hs01_00021989 predicted 361
7 SASI_Hs01_00021990 predicted 3220
8 SASI_Hs01_00021991 predicted 2631
9 SASI_Hs01_00021992 predicted 2532
10 SASI_Hs01_00021993 predicted 2432
11 SASI_Hs01_00021988 predicted 1384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231752 predicted 2595
2 SASI_Hs01_00231753 predicted 436
3 SASI_Hs01_00231754 predicted 1686
4 SASI_Hs02_00345539 predicted 3230
5 SASI_Hs01_00231755 predicted 2709
6 SASI_Hs01_00231757 predicted 365
7 SASI_Hs01_00231758 predicted 3224
8 SASI_Hs01_00231759 predicted 2634
9 SASI_Hs01_00231760 predicted 2527
10 SASI_Hs01_00231761 predicted 2437
11 SASI_Hs01_00231756 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234795 predicted 203
2 SASI_Rn02_00234796 predicted 3790
3 SASI_Rn02_00234797 predicted 1290
4 SASI_Rn02_00234798 predicted 1911
5 SASI_Rn02_00234799 predicted 1190
6 SASI_Rn02_00234800 predicted 3817
7 SASI_Rn02_00234801 predicted 2638
8 SASI_Rn02_00234802 predicted 1734
9 SASI_Rn02_00234803 predicted 3897
10 SASI_Rn02_00234804 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346131 predicted 1468
2 SASI_Mm02_00346132 predicted 587
3 SASI_Mm02_00346133 predicted 3927
4 SASI_Mm02_00346134 predicted 1433
5 SASI_Mm02_00346135 predicted 1261
6 SASI_Mm02_00346136 predicted 705
7 SASI_Mm02_00346137 predicted 1899
8 SASI_Mm02_00346138 predicted 2783
9 SASI_Mm02_00346139 predicted 1885
10 SASI_Mm02_00346140 predicted 3671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239581 predicted 1514
2 SASI_Mm01_00239582 predicted 634
3 SASI_Mm01_00239583 predicted 3973
4 SASI_Mm01_00239584 predicted 1073
5 SASI_Mm01_00239585 predicted 1478
6 SASI_Mm01_00239586 predicted 1294
7 SASI_Mm01_00239587 predicted 737
8 SASI_Mm01_00239588 predicted 3050
9 SASI_Mm01_00239589 predicted 204
10 SASI_Mm01_00239590 predicted 1923
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900639 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273801 predicted 1514
2 SASI_Mm01_00273802 predicted 3721
3 SASI_Mm01_00273803 predicted 635
4 SASI_Mm01_00273804 predicted 3997
5 SASI_Mm01_00273805 predicted 1070
6 SASI_Mm01_00273806 predicted 1479
7 SASI_Mm01_00273807 predicted 1294
8 SASI_Mm01_00273808 predicted 742
9 SASI_Mm01_00273809 predicted 3050
10 SASI_Mm01_00273810 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203644 predicted 1475
2 SASI_Mm01_00203645 predicted 595
3 SASI_Mm01_00203646 predicted 3936
4 SASI_Mm01_00203647 predicted 1031
5 SASI_Mm01_00203648 predicted 1442
6 SASI_Mm01_00203649 predicted 1268
7 SASI_Mm01_00203650 predicted 712
8 SASI_Mm01_00203651 predicted 3023
9 SASI_Mm01_00203652 predicted 1889
10 SASI_Mm01_00203653 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014381
VALIDATED
MLH3 MISSION shRNA Bacterial Glycerol Stock
mutL homolog 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014381.2-417s21c1
Sequence:CCGGGAAAGTGGGAAATCGTTATTTCTCGAGAAATAACGATTTCCCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014381.1-2503s1c1
Sequence:CCGGCGCTTAGAGAACTCTGATGTTCTCGAGAACATCAGAGTTCTCTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014381.1-903s1c1
Sequence:CCGGGCTACATAAACTCATTGACTTCTCGAGAAGTCAATGAGTTTATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014381.1-2936s1c1
Sequence:CCGGCCACACAGGATAATTCCTTTACTCGAGTAAAGGAATTATCCTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014381.1-3607s1c1
Sequence:CCGGGCTGAGAGCTTAGCAGTTAAACTCGAGTTTAACTGCTAAGCTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_014381.2-3123s21c1
Sequence:CCGGTTTGGTATTGCCCTATAATAACTCGAGTTATTATAGGGCAATACCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014381.2-1284s21c1
Sequence:CCGGATTATCAGGTGAGGATATTAACTCGAGTTAATATCCTCACCTGATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014381
VALIDATED
MLH3 MISSION shRNA shRNA Plasmid DNA
mutL homolog 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014381.2-417s21c1
Sequence:CCGGGAAAGTGGGAAATCGTTATTTCTCGAGAAATAACGATTTCCCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014381.1-2503s1c1
Sequence:CCGGCGCTTAGAGAACTCTGATGTTCTCGAGAACATCAGAGTTCTCTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014381.1-903s1c1
Sequence:CCGGGCTACATAAACTCATTGACTTCTCGAGAAGTCAATGAGTTTATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014381.1-2936s1c1
Sequence:CCGGCCACACAGGATAATTCCTTTACTCGAGTAAAGGAATTATCCTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014381.1-3607s1c1
Sequence:CCGGGCTGAGAGCTTAGCAGTTAAACTCGAGTTTAACTGCTAAGCTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_014381.2-3123s21c1
Sequence:CCGGTTTGGTATTGCCCTATAATAACTCGAGTTATTATAGGGCAATACCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014381.2-1284s21c1
Sequence:CCGGATTATCAGGTGAGGATATTAACTCGAGTTAATATCCTCACCTGATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014381
VALIDATED
MLH3 MISSION shRNA Lentiviral Transduction Particles
mutL homolog 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014381.2-417s21c1
Sequence:CCGGGAAAGTGGGAAATCGTTATTTCTCGAGAAATAACGATTTCCCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014381.1-2503s1c1
Sequence:CCGGCGCTTAGAGAACTCTGATGTTCTCGAGAACATCAGAGTTCTCTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014381.1-903s1c1
Sequence:CCGGGCTACATAAACTCATTGACTTCTCGAGAAGTCAATGAGTTTATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014381.1-2936s1c1
Sequence:CCGGCCACACAGGATAATTCCTTTACTCGAGTAAAGGAATTATCCTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014381.1-3607s1c1
Sequence:CCGGGCTGAGAGCTTAGCAGTTAAACTCGAGTTTAACTGCTAAGCTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_014381.2-3123s21c1
Sequence:CCGGTTTGGTATTGCCCTATAATAACTCGAGTTATTATAGGGCAATACCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014381.2-1284s21c1
Sequence:CCGGATTATCAGGTGAGGATATTAACTCGAGTTAATATCCTCACCTGATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175337
VALIDATED
MLH3 MISSION shRNA Bacterial Glycerol Stock
mutL homolog 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175337.1-291s21c1
Sequence:CCGGGAAGGTGGGAAACCGGTATTTCTCGAGAAATACCGGTTTCCCACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-1264s21c1
Sequence:CCGGAGTTTCCGGGAAGCGTGTAATCTCGAGATTACACGCTTCCCGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-4463s21c1
Sequence:CCGGCTCAAGCCTAAGGGTAGTTTACTCGAGTAAACTACCCTTAGGCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-988s21c1
Sequence:CCGGTCAGAACTCCACGGGATATATCTCGAGATATATCCCGTGGAGTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-518s21c1
Sequence:CCGGGGACTACAGTAACGGTCTATACTCGAGTATAGACCGTTACTGTAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175337
VALIDATED
MLH3 MISSION shRNA shRNA Plasmid DNA
mutL homolog 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175337.1-291s21c1
Sequence:CCGGGAAGGTGGGAAACCGGTATTTCTCGAGAAATACCGGTTTCCCACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-1264s21c1
Sequence:CCGGAGTTTCCGGGAAGCGTGTAATCTCGAGATTACACGCTTCCCGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-4463s21c1
Sequence:CCGGCTCAAGCCTAAGGGTAGTTTACTCGAGTAAACTACCCTTAGGCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-988s21c1
Sequence:CCGGTCAGAACTCCACGGGATATATCTCGAGATATATCCCGTGGAGTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-518s21c1
Sequence:CCGGGGACTACAGTAACGGTCTATACTCGAGTATAGACCGTTACTGTAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175337
VALIDATED
MLH3 MISSION shRNA Lentiviral Transduction Particles
mutL homolog 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175337.1-291s21c1
Sequence:CCGGGAAGGTGGGAAACCGGTATTTCTCGAGAAATACCGGTTTCCCACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-1264s21c1
Sequence:CCGGAGTTTCCGGGAAGCGTGTAATCTCGAGATTACACGCTTCCCGGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-4463s21c1
Sequence:CCGGCTCAAGCCTAAGGGTAGTTTACTCGAGTAAACTACCCTTAGGCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-988s21c1
Sequence:CCGGTCAGAACTCCACGGGATATATCTCGAGATATATCCCGTGGAGTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175337.1-518s21c1
Sequence:CCGGGGACTACAGTAACGGTCTATACTCGAGTATAGACCGTTACTGTAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)