EMAIL THIS PAGE TO A FRIEND

MLIP

muscular LMNA-interacting protein

219 Gene Product Result for
Synonyms: C6orf142
UniProtKB ID: Q5VWP3, B7Z2N0, Q96H08, Q96NF7
Gene ID:
Mouse(69642) muscular LMNA-interacting protein
Rat(681849) muscular LMNA-interacting protein
Zebrafish(492702) muscular LMNA-interacting protein
chicken(421889) muscular LMNA-interacting protein
dog(474943) muscular LMNA-interacting protein
Horse(100069574) muscular LMNA-interacting protein
cow(790110) muscular LMNA-interacting protein
domestic cat(101087319) muscular LMNA-interacting protein
naked mole-rat(101705154) muscular LMNA-interacting protein
domestic guinea pig(100731643) muscular LMNA-interacting protein
sheep(101108695) muscular LMNA-interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068771 MISSION® esiRNA esiRNA human C6orf142 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138569 Rosetta Predictions human pricing
XM_001058694 Rosetta Predictions rat pricing
XM_001478683 Rosetta Predictions mouse pricing
XM_001478691 Rosetta Predictions mouse pricing
XM_001480901 Rosetta Predictions mouse pricing
XM_001480902 Rosetta Predictions mouse pricing
XM_982820 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098967 predicted 389
2 SASI_Hs02_00363711 predicted 925
3 SASI_Hs02_00363712 predicted 626
4 SASI_Hs01_00098968 predicted 314
5 SASI_Hs01_00098969 predicted 484
6 SASI_Hs01_00098970 predicted 387
7 SASI_Hs01_00098971 predicted 349
8 SASI_Hs01_00098972 predicted 325
9 SASI_Hs01_00098973 predicted 1263
10 SASI_Hs01_00098975 predicted 1157
11 SASI_Hs01_00098974 predicted 846
12 SASI_Hs01_00098976 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290548 predicted 887
2 SASI_Rn02_00290549 predicted 1217
3 SASI_Rn02_00290550 predicted 1037
4 SASI_Rn02_00290551 predicted 1330
5 SASI_Rn02_00290552 predicted 2151
6 SASI_Rn02_00290553 predicted 1169
7 SASI_Rn02_00290554 predicted 2026
8 SASI_Rn02_00290555 predicted 229
9 SASI_Rn02_00290556 predicted 1982
10 SASI_Rn02_00290557 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00404578 predicted 207
2 SASI_Mm02_00404579 predicted 2276
3 SASI_Mm02_00404580 predicted 2349
4 SASI_Mm02_00404581 predicted 1863
5 SASI_Mm02_00404582 predicted 2448
6 SASI_Mm02_00404583 predicted 226
7 SASI_Mm02_00404584 predicted 300
8 SASI_Mm02_00404585 predicted 2103
9 SASI_Mm02_00404586 predicted 362
10 SASI_Mm02_00404587 predicted 2390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00404656 predicted 763
2 SASI_Mm02_00404657 predicted 667
3 SASI_Mm02_00404658 predicted 736
4 SASI_Mm02_00404659 predicted 830
5 SASI_Mm02_00404660 predicted 974
6 SASI_Mm02_00404661 predicted 608
7 SASI_Mm02_00404662 predicted 782
8 SASI_Mm02_00404663 predicted 624
9 SASI_Mm02_00404664 predicted 627
10 SASI_Mm02_00404665 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00420628 predicted 1163
2 SASI_Mm02_00420629 predicted 1348
3 SASI_Mm02_00420630 predicted 2167
4 SASI_Mm02_00420631 predicted 2239
5 SASI_Mm02_00420632 predicted 1542
6 SASI_Mm02_00420633 predicted 740
7 SASI_Mm02_00420634 predicted 2340
8 SASI_Mm02_00420635 predicted 618
9 SASI_Mm02_00420636 predicted 2002
10 SASI_Mm02_00420637 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00420638 predicted 760
2 SASI_Mm02_00420639 predicted 665
3 SASI_Mm02_00420640 predicted 738
4 SASI_Mm02_00420641 predicted 831
5 SASI_Mm02_00420642 predicted 971
6 SASI_Mm02_00420643 predicted 603
7 SASI_Mm02_00420644 predicted 777
8 SASI_Mm02_00420645 predicted 625
9 SASI_Mm02_00420646 predicted 625
10 SASI_Mm02_00420647 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_982820 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247198 predicted 214
2 SASI_Mm01_00247199 predicted 1164
3 SASI_Mm01_00247200 predicted 885
4 SASI_Mm01_00247201 predicted 963
5 SASI_Mm01_00247202 predicted 1227
6 SASI_Mm01_00247203 predicted 955
7 SASI_Mm01_00247204 predicted 1061
8 SASI_Mm01_00247205 predicted 227
9 SASI_Mm01_00247206 predicted 299
10 SASI_Mm01_00247207 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138569
MLIP MISSION shRNA Bacterial Glycerol Stock
muscular LMNA-interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-318s21c1
Sequence:CCGGGAAACTGTAAATAGGTCTAAACTCGAGTTTAGACCTATTTACAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-377s21c1
Sequence:CCGGAGAGAGAGACCAAGCGAAATTCTCGAGAATTTCGCTTGGTCTCTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138569.2-1544s21c1
Sequence:CCGGGCTAACCACTTGCTAGATTTACTCGAGTAAATCTAGCAAGTGGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-1435s21c1
Sequence:CCGGGTCATCCAATGGTGGCTATTCCTCGAGGAATAGCCACCATTGGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-1250s21c1
Sequence:CCGGTGTCTCGCTCCATCCTTTATACTCGAGTATAAAGGATGGAGCGAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138569.1-123s1c1
Sequence:CCGGGCCAAACCTCTGATCTTCACACTCGAGTGTGAAGATCAGAGGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138569.1-1122s1c1
Sequence:CCGGGAAGATAACAGCGACCTCTTTCTCGAGAAAGAGGTCGCTGTTATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138569.1-1509s1c1
Sequence:CCGGCAGAATGAGTGCTCCCTTTATCTCGAGATAAAGGGAGCACTCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138569.1-1392s1c1
Sequence:CCGGGCTCTTGATTCCAAAGAGCAACTCGAGTTGCTCTTTGGAATCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138569.1-834s1c1
Sequence:CCGGGCTACCATTGATAAGGTCTTACTCGAGTAAGACCTTATCAATGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138569
MLIP MISSION shRNA shRNA Plasmid DNA
muscular LMNA-interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-318s21c1
Sequence:CCGGGAAACTGTAAATAGGTCTAAACTCGAGTTTAGACCTATTTACAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-377s21c1
Sequence:CCGGAGAGAGAGACCAAGCGAAATTCTCGAGAATTTCGCTTGGTCTCTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138569.2-1544s21c1
Sequence:CCGGGCTAACCACTTGCTAGATTTACTCGAGTAAATCTAGCAAGTGGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-1435s21c1
Sequence:CCGGGTCATCCAATGGTGGCTATTCCTCGAGGAATAGCCACCATTGGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-1250s21c1
Sequence:CCGGTGTCTCGCTCCATCCTTTATACTCGAGTATAAAGGATGGAGCGAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138569.1-123s1c1
Sequence:CCGGGCCAAACCTCTGATCTTCACACTCGAGTGTGAAGATCAGAGGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138569.1-1122s1c1
Sequence:CCGGGAAGATAACAGCGACCTCTTTCTCGAGAAAGAGGTCGCTGTTATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138569.1-1509s1c1
Sequence:CCGGCAGAATGAGTGCTCCCTTTATCTCGAGATAAAGGGAGCACTCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138569.1-1392s1c1
Sequence:CCGGGCTCTTGATTCCAAAGAGCAACTCGAGTTGCTCTTTGGAATCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138569.1-834s1c1
Sequence:CCGGGCTACCATTGATAAGGTCTTACTCGAGTAAGACCTTATCAATGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138569
MLIP MISSION shRNA Lentiviral Transduction Particles
muscular LMNA-interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-318s21c1
Sequence:CCGGGAAACTGTAAATAGGTCTAAACTCGAGTTTAGACCTATTTACAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-377s21c1
Sequence:CCGGAGAGAGAGACCAAGCGAAATTCTCGAGAATTTCGCTTGGTCTCTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138569.2-1544s21c1
Sequence:CCGGGCTAACCACTTGCTAGATTTACTCGAGTAAATCTAGCAAGTGGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-1435s21c1
Sequence:CCGGGTCATCCAATGGTGGCTATTCCTCGAGGAATAGCCACCATTGGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138569.2-1250s21c1
Sequence:CCGGTGTCTCGCTCCATCCTTTATACTCGAGTATAAAGGATGGAGCGAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138569.1-123s1c1
Sequence:CCGGGCCAAACCTCTGATCTTCACACTCGAGTGTGAAGATCAGAGGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138569.1-1122s1c1
Sequence:CCGGGAAGATAACAGCGACCTCTTTCTCGAGAAAGAGGTCGCTGTTATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138569.1-1509s1c1
Sequence:CCGGCAGAATGAGTGCTCCCTTTATCTCGAGATAAAGGGAGCACTCATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138569.1-1392s1c1
Sequence:CCGGGCTCTTGATTCCAAAGAGCAACTCGAGTTGCTCTTTGGAATCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138569.1-834s1c1
Sequence:CCGGGCTACCATTGATAAGGTCTTACTCGAGTAAGACCTTATCAATGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027150
MLIP MISSION shRNA Bacterial Glycerol Stock
muscular LMNA-interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-437s21c1
Sequence:CCGGGCCCAAGTCTCTGGCTATTTCCTCGAGGAAATAGCCAGAGACTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-860s21c1
Sequence:CCGGGCCCAACCCTTTCAGTAAATACTCGAGTATTTACTGAAAGGGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-784s21c1
Sequence:CCGGTGACTAAGCCTGGAGTAATTCCTCGAGGAATTACTCCAGGCTTAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027150.1-971s21c1
Sequence:CCGGCATGGCCAACTACTTGCTAAACTCGAGTTTAGCAAGTAGTTGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-176s21c1
Sequence:CCGGGTTTGAGTACAGTGATCATATCTCGAGATATGATCACTGTACTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027150
MLIP MISSION shRNA shRNA Plasmid DNA
muscular LMNA-interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-437s21c1
Sequence:CCGGGCCCAAGTCTCTGGCTATTTCCTCGAGGAAATAGCCAGAGACTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-860s21c1
Sequence:CCGGGCCCAACCCTTTCAGTAAATACTCGAGTATTTACTGAAAGGGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-784s21c1
Sequence:CCGGTGACTAAGCCTGGAGTAATTCCTCGAGGAATTACTCCAGGCTTAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027150.1-971s21c1
Sequence:CCGGCATGGCCAACTACTTGCTAAACTCGAGTTTAGCAAGTAGTTGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-176s21c1
Sequence:CCGGGTTTGAGTACAGTGATCATATCTCGAGATATGATCACTGTACTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027150
MLIP MISSION shRNA Lentiviral Transduction Particles
muscular LMNA-interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-437s21c1
Sequence:CCGGGCCCAAGTCTCTGGCTATTTCCTCGAGGAAATAGCCAGAGACTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-860s21c1
Sequence:CCGGGCCCAACCCTTTCAGTAAATACTCGAGTATTTACTGAAAGGGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-784s21c1
Sequence:CCGGTGACTAAGCCTGGAGTAATTCCTCGAGGAATTACTCCAGGCTTAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027150.1-971s21c1
Sequence:CCGGCATGGCCAACTACTTGCTAAACTCGAGTTTAGCAAGTAGTTGGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027150.1-176s21c1
Sequence:CCGGGTTTGAGTACAGTGATCATATCTCGAGATATGATCACTGTACTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)