EMAIL THIS PAGE TO A FRIEND

MLKL

mixed lineage kinase domain-like

93 Gene Product Result for
UniProtKB ID: Q8NB16, A6NCE4, Q8N6V0
Gene ID:
Mouse(74568) mixed lineage kinase domain-like
Rat(690743) mixed lineage kinase domain-like
chicken(415686) mixed lineage kinase domain-like
cow(790225) mixed lineage kinase domain-like
sheep(101115147) mixed lineage kinase domain-like
domestic guinea pig(100715708) mixed lineage kinase domain-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_356104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_029005 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029005 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029005 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152649 Rosetta Predictions human pricing
XM_001075467 Rosetta Predictions rat pricing
NM_029005 Rosetta Predictions mouse pricing
XM_356104 Rosetta Predictions mouse pricing
XM_895027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025019 predicted 1215
2 SASI_Hs01_00025020 predicted 1477
3 SASI_Hs01_00025021 predicted 889
4 SASI_Hs01_00025022 predicted 1439
5 SASI_Hs01_00025023 predicted 1514
6 SASI_Hs01_00025024 predicted 680
7 SASI_Hs01_00025025 predicted 1383
8 SASI_Hs01_00025026 predicted 1075
9 SASI_Hs01_00025027 predicted 1268
10 SASI_Hs01_00025028 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349854 predicted 266
2 SASI_Rn02_00349855 predicted 739
3 SASI_Rn02_00349856 predicted 648
4 SASI_Rn02_00349857 predicted 553
5 SASI_Rn02_00349858 predicted 752
6 SASI_Rn02_00349859 predicted 855
7 SASI_Rn02_00349860 predicted 565
8 SASI_Rn02_00349861 predicted 762
9 SASI_Rn02_00349862 predicted 606
10 SASI_Rn02_00349863 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334733 predicted 609
2 SASI_Mm02_00334734 predicted 723
3 SASI_Mm02_00334735 predicted 763
4 SASI_Mm02_00334736 predicted 871
5 SASI_Mm02_00334737 predicted 326
6 SASI_Mm02_00334738 predicted 945
7 SASI_Mm02_00334739 predicted 663
8 SASI_Mm02_00334740 predicted 693
9 SASI_Mm02_00334741 predicted 820
10 SASI_Mm02_00334742 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237456 predicted 911
2 SASI_Mm01_00237457 predicted 1030
3 SASI_Mm01_00237458 predicted 1071
4 SASI_Mm01_00237459 predicted 624
5 SASI_Mm01_00237460 predicted 382
6 SASI_Mm01_00237461 predicted 1246
7 SASI_Mm01_00237462 predicted 972
8 SASI_Mm01_00237463 predicted 1132
9 SASI_Mm01_00237464 predicted 1137
10 SASI_Mm01_00237465 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213098 predicted 918
2 SASI_Mm01_00213099 predicted 1022
3 SASI_Mm01_00213100 predicted 1074
4 SASI_Mm01_00213101 predicted 630
5 SASI_Mm01_00213102 predicted 390
6 SASI_Mm01_00213103 predicted 1248
7 SASI_Mm01_00213104 predicted 974
8 SASI_Mm01_00213105 predicted 1130
9 SASI_Mm01_00213106 predicted 1139
10 SASI_Mm01_00213107 predicted 923
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152649
VALIDATED
MLKL MISSION shRNA Bacterial Glycerol Stock
mixed lineage kinase domain-like
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-1269s1c1
Sequence:CCGGGCCTCAATTCTCCATTGTCATCTCGAGATGACAATGGAGAATTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-2189s1c1
Sequence:CCGGGTGACTTGATTTGATCAATAGCTCGAGCTATTGATCAAATCAAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152649.1-1811s1c1
Sequence:CCGGCCTCTGTGGATGAAATCTTAACTCGAGTTAAGATTTCATCCACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-916s1c1
Sequence:CCGGGAAGCTTCACTGAGACGATTACTCGAGTAATCGTCTCAGTGAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-1550s1c1
Sequence:CCGGGAGTCAAATCTACAGCATATCCTCGAGGATATGCTGTAGATTTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-2052s1c1
Sequence:CCGGCCTCTGACAGTAACTTTGATACTCGAGTATCAAAGTTACTGTCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152649.x-498s1c1
Sequence:CCGGAGAGATGAAATACTGCAAGAACTCGAGTTCTTGCAGTATTTCATCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152649.x-1230s1c1
Sequence:CCGGGCGTATATTTGGGATTTGCATCTCGAGATGCAAATCCCAAATATACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.x-1670s1c1
Sequence:CCGGTCCCGTTTCAAGGCTGTAATTCTCGAGAATTACAGCCTTGAAACGGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.x-1219s1c1
Sequence:CCGGCCCAACATCCTGCGTATATTTCTCGAGAAATATACGCAGGATGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.x-1935s1c1
Sequence:CCGGCCTTCGGCATTGGGTTATCTACTCGAGTAGATAACCCAATGCCGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152649.2-1936s21c1
Sequence:CCGGCCTTCGGCATTGGGTTATCTACTCGAGTAGATAACCCAATGCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152649.2-2054s21c1
Sequence:CCGGCCTCTGACAGTAACTTTGATACTCGAGTATCAAAGTTACTGTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152649.2-1219s21c1
Sequence:CCGGCCCAACATCCTGCGTATATTTCTCGAGAAATATACGCAGGATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152649.2-916s21c1
Sequence:CCGGGAAGCTTCACTGAGACGATTACTCGAGTAATCGTCTCAGTGAAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152649
VALIDATED
MLKL MISSION shRNA shRNA Plasmid DNA
mixed lineage kinase domain-like
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-1269s1c1
Sequence:CCGGGCCTCAATTCTCCATTGTCATCTCGAGATGACAATGGAGAATTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-2189s1c1
Sequence:CCGGGTGACTTGATTTGATCAATAGCTCGAGCTATTGATCAAATCAAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152649.1-1811s1c1
Sequence:CCGGCCTCTGTGGATGAAATCTTAACTCGAGTTAAGATTTCATCCACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-916s1c1
Sequence:CCGGGAAGCTTCACTGAGACGATTACTCGAGTAATCGTCTCAGTGAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-1550s1c1
Sequence:CCGGGAGTCAAATCTACAGCATATCCTCGAGGATATGCTGTAGATTTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-2052s1c1
Sequence:CCGGCCTCTGACAGTAACTTTGATACTCGAGTATCAAAGTTACTGTCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152649.x-498s1c1
Sequence:CCGGAGAGATGAAATACTGCAAGAACTCGAGTTCTTGCAGTATTTCATCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152649.x-1230s1c1
Sequence:CCGGGCGTATATTTGGGATTTGCATCTCGAGATGCAAATCCCAAATATACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.x-1670s1c1
Sequence:CCGGTCCCGTTTCAAGGCTGTAATTCTCGAGAATTACAGCCTTGAAACGGGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.x-1219s1c1
Sequence:CCGGCCCAACATCCTGCGTATATTTCTCGAGAAATATACGCAGGATGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.x-1935s1c1
Sequence:CCGGCCTTCGGCATTGGGTTATCTACTCGAGTAGATAACCCAATGCCGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152649.2-1936s21c1
Sequence:CCGGCCTTCGGCATTGGGTTATCTACTCGAGTAGATAACCCAATGCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152649.2-2054s21c1
Sequence:CCGGCCTCTGACAGTAACTTTGATACTCGAGTATCAAAGTTACTGTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152649.2-1219s21c1
Sequence:CCGGCCCAACATCCTGCGTATATTTCTCGAGAAATATACGCAGGATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152649.2-916s21c1
Sequence:CCGGGAAGCTTCACTGAGACGATTACTCGAGTAATCGTCTCAGTGAAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152649
VALIDATED
MLKL MISSION shRNA Lentiviral Transduction Particles
mixed lineage kinase domain-like
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-1269s1c1
Sequence:CCGGGCCTCAATTCTCCATTGTCATCTCGAGATGACAATGGAGAATTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196761    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-2189s1c1
Sequence:CCGGGTGACTTGATTTGATCAATAGCTCGAGCTATTGATCAAATCAAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152649.1-1811s1c1
Sequence:CCGGCCTCTGTGGATGAAATCTTAACTCGAGTTAAGATTTCATCCACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-916s1c1
Sequence:CCGGGAAGCTTCACTGAGACGATTACTCGAGTAATCGTCTCAGTGAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-1550s1c1
Sequence:CCGGGAGTCAAATCTACAGCATATCCTCGAGGATATGCTGTAGATTTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.1-2052s1c1
Sequence:CCGGCCTCTGACAGTAACTTTGATACTCGAGTATCAAAGTTACTGTCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152649.x-498s1c1
Sequence:CCGGAGAGATGAAATACTGCAAGAACTCGAGTTCTTGCAGTATTTCATCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152649.x-1230s1c1
Sequence:CCGGGCGTATATTTGGGATTTGCATCTCGAGATGCAAATCCCAAATATACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.x-1670s1c1
Sequence:CCGGTCCCGTTTCAAGGCTGTAATTCTCGAGAATTACAGCCTTGAAACGGGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.x-1219s1c1
Sequence:CCGGCCCAACATCCTGCGTATATTTCTCGAGAAATATACGCAGGATGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_152649.x-1935s1c1
Sequence:CCGGCCTTCGGCATTGGGTTATCTACTCGAGTAGATAACCCAATGCCGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152649.2-1936s21c1
Sequence:CCGGCCTTCGGCATTGGGTTATCTACTCGAGTAGATAACCCAATGCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152649.2-2054s21c1
Sequence:CCGGCCTCTGACAGTAACTTTGATACTCGAGTATCAAAGTTACTGTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152649.2-1219s21c1
Sequence:CCGGCCCAACATCCTGCGTATATTTCTCGAGAAATATACGCAGGATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152649.2-916s21c1
Sequence:CCGGGAAGCTTCACTGAGACGATTACTCGAGTAATCGTCTCAGTGAAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356104
VALIDATED
MLKL MISSION shRNA Bacterial Glycerol Stock
mixed lineage kinase domain-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-579s1c1
Sequence:CCGGCCTGAAGCAATGCTCACTAAACTCGAGTTTAGTGAGCATTGCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-1087s1c1
Sequence:CCGGGCAGGATTTGAGTTAAGCAAACTCGAGTTTGCTTAACTCAAATCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-879s1c1
Sequence:CCGGCCCTGAGTTCTCCATTGTCATCTCGAGATGACAATGGAGAACTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-1126s1c1
Sequence:CCGGCGGACAGCAAAGAGCACTAAACTCGAGTTTAGTGCTCTTTGCTGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-439s1c1
Sequence:CCGGCATTGGAATACCGTTTCAGATCTCGAGATCTGAAACGGTATTCCAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356104
VALIDATED
MLKL MISSION shRNA shRNA Plasmid DNA
mixed lineage kinase domain-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-579s1c1
Sequence:CCGGCCTGAAGCAATGCTCACTAAACTCGAGTTTAGTGAGCATTGCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-1087s1c1
Sequence:CCGGGCAGGATTTGAGTTAAGCAAACTCGAGTTTGCTTAACTCAAATCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-879s1c1
Sequence:CCGGCCCTGAGTTCTCCATTGTCATCTCGAGATGACAATGGAGAACTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-1126s1c1
Sequence:CCGGCGGACAGCAAAGAGCACTAAACTCGAGTTTAGTGCTCTTTGCTGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-439s1c1
Sequence:CCGGCATTGGAATACCGTTTCAGATCTCGAGATCTGAAACGGTATTCCAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356104
VALIDATED
MLKL MISSION shRNA Lentiviral Transduction Particles
mixed lineage kinase domain-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-579s1c1
Sequence:CCGGCCTGAAGCAATGCTCACTAAACTCGAGTTTAGTGAGCATTGCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-1087s1c1
Sequence:CCGGGCAGGATTTGAGTTAAGCAAACTCGAGTTTGCTTAACTCAAATCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-879s1c1
Sequence:CCGGCCCTGAGTTCTCCATTGTCATCTCGAGATGACAATGGAGAACTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-1126s1c1
Sequence:CCGGCGGACAGCAAAGAGCACTAAACTCGAGTTTAGTGCTCTTTGCTGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_356104.1-439s1c1
Sequence:CCGGCATTGGAATACCGTTTCAGATCTCGAGATCTGAAACGGTATTCCAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029005
VALIDATED
MLKL MISSION shRNA Bacterial Glycerol Stock
mixed lineage kinase domain-like
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029005.2-1151s21c1
Sequence:CCGGAGATCCAGTTCAACGATATATCTCGAGATATATCGTTGAACTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029005.2-826s21c1
Sequence:CCGGTCCCAACATCTTGCGTATATTCTCGAGAATATACGCAAGATGTTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029005.2-1060s21c1
Sequence:CCGGAGCCGGAGGCTACCAAGTAAACTCGAGTTTACTTGGTAGCCTCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029005
VALIDATED
MLKL MISSION shRNA shRNA Plasmid DNA
mixed lineage kinase domain-like
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029005.2-1151s21c1
Sequence:CCGGAGATCCAGTTCAACGATATATCTCGAGATATATCGTTGAACTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029005.2-826s21c1
Sequence:CCGGTCCCAACATCTTGCGTATATTCTCGAGAATATACGCAAGATGTTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029005.2-1060s21c1
Sequence:CCGGAGCCGGAGGCTACCAAGTAAACTCGAGTTTACTTGGTAGCCTCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029005
VALIDATED
MLKL MISSION shRNA Lentiviral Transduction Particles
mixed lineage kinase domain-like
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029005.2-1151s21c1
Sequence:CCGGAGATCCAGTTCAACGATATATCTCGAGATATATCGTTGAACTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029005.2-826s21c1
Sequence:CCGGTCCCAACATCTTGCGTATATTCTCGAGAATATACGCAAGATGTTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029005.2-1060s21c1
Sequence:CCGGAGCCGGAGGCTACCAAGTAAACTCGAGTTTACTTGGTAGCCTCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)