EMAIL THIS PAGE TO A FRIEND

MLLT10

myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10

248 Gene Product Result for
Synonyms: AF10
UniProtKB ID: P55197, B1ANA8, Q5JT37, Q5VX90, Q66K63
Gene ID:
Human(8028) Summary: This gene encodes a transcription factor and has been identified as a partner gene involved in several chromosomal rearrangements resulting in various leukemias. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
Mouse(17354) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Rat(361285) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Zebrafish(492342) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
cow(790884) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
cow(787416) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
domestic cat(101095180) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
dog(487096) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
chicken(420509) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
domestic guinea pig(100719388) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
naked mole-rat(101706801) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Domestic Rabbit(100342728) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
sheep(101113089) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010804 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010804 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010804 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004641 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009569 Rosetta Predictions human pricing
NM_004641 Rosetta Predictions human pricing
NM_001012162 Rosetta Predictions rat pricing
XM_577602 Rosetta Predictions rat pricing
NM_010804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029318 predicted 2059
2 SASI_Hs01_00029319 predicted 3107
3 SASI_Hs01_00029320 predicted 1183
4 SASI_Hs01_00029321 predicted 948
5 SASI_Hs01_00029322 predicted 1342
6 SASI_Hs01_00029323 predicted 2073
7 SASI_Hs02_00305640 predicted 1330
8 SASI_Hs01_00029324 predicted 1138
9 SASI_Hs01_00029325 predicted 1348
10 SASI_Hs01_00029326 predicted 2439
11 SASI_Hs01_00029327 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073491 predicted 2460
2 SASI_Hs01_00073492 predicted 3496
3 SASI_Hs01_00073493 predicted 1526
4 SASI_Hs01_00073494 predicted 1288
5 SASI_Hs01_00073495 predicted 1684
6 SASI_Hs01_00073496 predicted 2471
7 SASI_Hs02_00338049 predicted 1680
8 SASI_Hs01_00073497 predicted 1489
9 SASI_Hs01_00073498 predicted 1699
10 SASI_Hs01_00073499 predicted 2832
11 SASI_Hs01_00073500 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200354 predicted 436
2 SASI_Rn01_00106040 predicted 2530
3 SASI_Rn01_00106041 predicted 2181
4 SASI_Rn01_00106042 predicted 1306
5 SASI_Rn01_00106045 predicted 2086
6 SASI_Rn01_00106046 predicted 1597
7 SASI_Rn01_00106047 predicted 2550
8 SASI_Rn01_00106048 predicted 2552
9 SASI_Rn01_00106049 predicted 386
10 SASI_Rn02_00200355 predicted 2456
11 SASI_Rn01_00106043 predicted 2569
12 SASI_Rn01_00106044 predicted 1772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144144 predicted 2182
2 SASI_Rn01_00144145 predicted 2348
3 SASI_Rn01_00144146 predicted 1993
4 SASI_Rn01_00144147 predicted 2002
5 SASI_Rn01_00144148 predicted 2373
6 SASI_Rn01_00144149 predicted 2268
7 SASI_Rn01_00144150 predicted 2360
8 SASI_Rn01_00144151 predicted 2370
9 SASI_Rn01_00144152 predicted 2273
10 SASI_Rn01_00144153 predicted 2064
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122653 predicted 416
2 SASI_Mm01_00122654 predicted 2180
3 SASI_Mm01_00122655 predicted 1590
4 SASI_Mm01_00122656 predicted 1050
5 SASI_Mm01_00122657 predicted 1754
6 SASI_Mm02_00319381 predicted 1716
7 SASI_Mm01_00122658 predicted 2243
8 SASI_Mm01_00122659 predicted 2833
9 SASI_Mm01_00122660 predicted 2816
10 SASI_Mm01_00122661 predicted 2842
11 SASI_Mm01_00122662 predicted 2538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010804
MLLT10 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010804.2-4051s1c1
Sequence:CCGGGCAAGGTTCTAGCATCAAATTCTCGAGAATTTGATGCTAGAACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-2537s1c1
Sequence:CCGGCAGCAGTAAGAGCCCACATATCTCGAGATATGTGGGCTCTTACTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-599s1c1
Sequence:CCGGCCATGTAACATGTGCTCAGTTCTCGAGAACTGAGCACATGTTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-1372s1c1
Sequence:CCGGCGACTGTTATTTCACAGCCTACTCGAGTAGGCTGTGAAATAACAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-2020s1c1
Sequence:CCGGCCCATATGTATGGCAGTAGATCTCGAGATCTACTGCCATACATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010804
MLLT10 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010804.2-4051s1c1
Sequence:CCGGGCAAGGTTCTAGCATCAAATTCTCGAGAATTTGATGCTAGAACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-2537s1c1
Sequence:CCGGCAGCAGTAAGAGCCCACATATCTCGAGATATGTGGGCTCTTACTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-599s1c1
Sequence:CCGGCCATGTAACATGTGCTCAGTTCTCGAGAACTGAGCACATGTTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-1372s1c1
Sequence:CCGGCGACTGTTATTTCACAGCCTACTCGAGTAGGCTGTGAAATAACAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-2020s1c1
Sequence:CCGGCCCATATGTATGGCAGTAGATCTCGAGATCTACTGCCATACATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010804
MLLT10 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010804.2-4051s1c1
Sequence:CCGGGCAAGGTTCTAGCATCAAATTCTCGAGAATTTGATGCTAGAACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-2537s1c1
Sequence:CCGGCAGCAGTAAGAGCCCACATATCTCGAGATATGTGGGCTCTTACTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-599s1c1
Sequence:CCGGCCATGTAACATGTGCTCAGTTCTCGAGAACTGAGCACATGTTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-1372s1c1
Sequence:CCGGCGACTGTTATTTCACAGCCTACTCGAGTAGGCTGTGAAATAACAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010804.2-2020s1c1
Sequence:CCGGCCCATATGTATGGCAGTAGATCTCGAGATCTACTGCCATACATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004641
VALIDATED
MLLT10 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-2673s1c1
Sequence:CCGGCCCTCATATAGGAAACAGCTTCTCGAGAAGCTGTTTCCTATATGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-681s1c1
Sequence:CCGGCCATGTAACATGCGCTCAGTTCTCGAGAACTGAGCGCATGTTACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004641.1-3344s1c1
Sequence:CCGGCCTGCTGTTCTAGCACTTCATCTCGAGATGAAGTGCTAGAACAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-3092s1c1
Sequence:CCGGCCTCAGGACTAGGATTACTTTCTCGAGAAAGTAATCCTAGTCCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-1295s1c1
Sequence:CCGGCCCAGGATTTCCTGAGCTTTACTCGAGTAAAGCTCAGGAAATCCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-1197s21c1
Sequence:CCGGAGATACTACTGCACGATTTACCTCGAGGTAAATCGTGCAGTAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-1154s21c1
Sequence:CCGGGCACTAGCAACAACTCTATATCTCGAGATATAGAGTTGTTGCTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-730s21c1
Sequence:CCGGGTTCCGCATGATCGTTATAATCTCGAGATTATAACGATCATGCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004641.2-4133s21c1
Sequence:CCGGTGTTAAGACCTACTCATATTTCTCGAGAAATATGAGTAGGTCTTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-3106s21c1
Sequence:CCGGGGTAACCAACTGGCAATTAATCTCGAGATTAATTGCCAGTTGGTTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004641
VALIDATED
MLLT10 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-2673s1c1
Sequence:CCGGCCCTCATATAGGAAACAGCTTCTCGAGAAGCTGTTTCCTATATGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-681s1c1
Sequence:CCGGCCATGTAACATGCGCTCAGTTCTCGAGAACTGAGCGCATGTTACATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004641.1-3344s1c1
Sequence:CCGGCCTGCTGTTCTAGCACTTCATCTCGAGATGAAGTGCTAGAACAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-3092s1c1
Sequence:CCGGCCTCAGGACTAGGATTACTTTCTCGAGAAAGTAATCCTAGTCCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-1295s1c1
Sequence:CCGGCCCAGGATTTCCTGAGCTTTACTCGAGTAAAGCTCAGGAAATCCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-1197s21c1
Sequence:CCGGAGATACTACTGCACGATTTACCTCGAGGTAAATCGTGCAGTAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-1154s21c1
Sequence:CCGGGCACTAGCAACAACTCTATATCTCGAGATATAGAGTTGTTGCTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-730s21c1
Sequence:CCGGGTTCCGCATGATCGTTATAATCTCGAGATTATAACGATCATGCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004641.2-4133s21c1
Sequence:CCGGTGTTAAGACCTACTCATATTTCTCGAGAAATATGAGTAGGTCTTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-3106s21c1
Sequence:CCGGGGTAACCAACTGGCAATTAATCTCGAGATTAATTGCCAGTTGGTTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004641
VALIDATED
MLLT10 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-2673s1c1
Sequence:CCGGCCCTCATATAGGAAACAGCTTCTCGAGAAGCTGTTTCCTATATGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-681s1c1
Sequence:CCGGCCATGTAACATGCGCTCAGTTCTCGAGAACTGAGCGCATGTTACATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_004641.1-3344s1c1
Sequence:CCGGCCTGCTGTTCTAGCACTTCATCTCGAGATGAAGTGCTAGAACAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-3092s1c1
Sequence:CCGGCCTCAGGACTAGGATTACTTTCTCGAGAAAGTAATCCTAGTCCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004641.1-1295s1c1
Sequence:CCGGCCCAGGATTTCCTGAGCTTTACTCGAGTAAAGCTCAGGAAATCCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-1197s21c1
Sequence:CCGGAGATACTACTGCACGATTTACCTCGAGGTAAATCGTGCAGTAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-1154s21c1
Sequence:CCGGGCACTAGCAACAACTCTATATCTCGAGATATAGAGTTGTTGCTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-730s21c1
Sequence:CCGGGTTCCGCATGATCGTTATAATCTCGAGATTATAACGATCATGCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004641.2-4133s21c1
Sequence:CCGGTGTTAAGACCTACTCATATTTCTCGAGAAATATGAGTAGGTCTTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004641.2-3106s21c1
Sequence:CCGGGGTAACCAACTGGCAATTAATCTCGAGATTAATTGCCAGTTGGTTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)