EMAIL THIS PAGE TO A FRIEND

MLLT11

myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11

58 Gene Product Result for
Synonyms: AF1Q RP11-316M1.10
UniProtKB ID: Q13015
Gene ID:
Human(10962) Summary: The gene variously symbolized ALL1, HRX, or MLL located on 11q23 has been demonstrated to be fused with a number of translocation partners in cases of leukemia. t(1;11)(q21;q23) translocations that fused the MLL gene to a gene on chromosomal band 1q21 in 2 infants with acute myelomonocytic leukemia have been demonstrated. The N-terminal portion of the MLL gene is critical for leukemogenesis in translocations involving band 11q23. This gene encodes 90 amino acids. It was found to be highly expressed in the thymus but not in peripheral lymphoid tissues. In contrast to its restricted distribution in normal hematopoietic tissue, this gene was expressed in all leukemic cell lines tested. [provided by RefSeq, Jul 2008]
Mouse(56772) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Rat(295264) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Zebrafish(563531) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
dog(100682887) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
cow(539519) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
domestic cat(101096085) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
sheep(101111063) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
naked mole-rat(101709641) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
domestic guinea pig(100729311) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006818 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006818 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006818 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061531 MISSION® esiRNA esiRNA targeting mouse Mllt11 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006818 Rosetta Predictions human pricing
NM_001013912 Rosetta Predictions rat pricing
NM_019914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176860 predicted 902
2 SASI_Hs01_00176861 predicted 1241
3 SASI_Hs01_00176862 predicted 1282
4 SASI_Hs01_00176864 predicted 985
5 SASI_Hs01_00176865 predicted 1304
6 SASI_Hs01_00176867 predicted 1256
7 SASI_Hs01_00176868 predicted 1287
8 SASI_Hs01_00176869 predicted 885
9 SASI_Hs02_00342362 predicted 1110
10 SASI_Hs02_00342363 predicted 1256
11 SASI_Hs01_00176863 predicted 1289
12 SASI_Hs01_00176866 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047638 predicted 156
2 SASI_Rn01_00047639 predicted 534
3 SASI_Rn01_00047640 predicted 647
4 SASI_Rn01_00047641 predicted 58
5 SASI_Rn02_00201200 predicted 766
6 SASI_Rn02_00201201 predicted 373
7 SASI_Rn01_00047642 predicted 554
8 SASI_Rn01_00047643 predicted 659
9 SASI_Rn01_00047644 predicted 139
10 SASI_Rn01_00047645 predicted 541
11 SASI_Rn01_00047646 predicted 131
12 SASI_Rn01_00047647 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133383 predicted 221
2 SASI_Mm02_00325190 predicted 210
3 SASI_Mm01_00133382 predicted 838
4 SASI_Mm01_00133384 predicted 780
5 SASI_Mm01_00133386 predicted 594
6 SASI_Mm01_00133387 predicted 335
7 SASI_Mm01_00133388 predicted 593
8 SASI_Mm01_00133389 predicted 442
9 SASI_Mm01_00133390 predicted 324
10 SASI_Mm02_00325191 predicted 412
11 SASI_Mm01_00133385 predicted 811
12 SASI_Mm01_00133391 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006818
VALIDATED
MLLT11 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006818.3-1137s21c1
Sequence:CCGGCTTCGAACTGGACTTGCTCTACTCGAGTAGAGCAAGTCCAGTTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006818.3-1283s21c1
Sequence:CCGGGCCAGAGTTGAGTTCTATGTACTCGAGTACATAGAACTCAACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006818.3-992s21c1
Sequence:CCGGCCACCTACAAGGTCAAAGACACTCGAGTGTCTTTGACCTTGTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006818.2-459s1c1
Sequence:CCGGCCACCTACAAGGTCAAAGACACTCGAGTGTCTTTGACCTTGTAGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006818.2-750s1c1
Sequence:CCGGGCCAGAGTTGAGTTCTATGTACTCGAGTACATAGAACTCAACTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006818.2-445s1c1
Sequence:CCGGTCTGTCAGATACAGCCACCTACTCGAGTAGGTGGCTGTATCTGACAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006818.2-604s1c1
Sequence:CCGGCTTCGAACTGGACTTGCTCTACTCGAGTAGAGCAAGTCCAGTTCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006818.2-550s1c1
Sequence:CCGGCCTTGAGTACAGCACCTTCAACTCGAGTTGAAGGTGCTGTACTCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006818.3-1083s21c1
Sequence:CCGGCCTTGAGTACAGCACCTTCAACTCGAGTTGAAGGTGCTGTACTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006818
VALIDATED
MLLT11 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006818.3-1137s21c1
Sequence:CCGGCTTCGAACTGGACTTGCTCTACTCGAGTAGAGCAAGTCCAGTTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006818.3-1283s21c1
Sequence:CCGGGCCAGAGTTGAGTTCTATGTACTCGAGTACATAGAACTCAACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006818.3-992s21c1
Sequence:CCGGCCACCTACAAGGTCAAAGACACTCGAGTGTCTTTGACCTTGTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006818.2-459s1c1
Sequence:CCGGCCACCTACAAGGTCAAAGACACTCGAGTGTCTTTGACCTTGTAGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006818.2-750s1c1
Sequence:CCGGGCCAGAGTTGAGTTCTATGTACTCGAGTACATAGAACTCAACTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006818.2-445s1c1
Sequence:CCGGTCTGTCAGATACAGCCACCTACTCGAGTAGGTGGCTGTATCTGACAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006818.2-604s1c1
Sequence:CCGGCTTCGAACTGGACTTGCTCTACTCGAGTAGAGCAAGTCCAGTTCGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006818.2-550s1c1
Sequence:CCGGCCTTGAGTACAGCACCTTCAACTCGAGTTGAAGGTGCTGTACTCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006818.3-1083s21c1
Sequence:CCGGCCTTGAGTACAGCACCTTCAACTCGAGTTGAAGGTGCTGTACTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006818
VALIDATED
MLLT11 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006818.3-1137s21c1
Sequence:CCGGCTTCGAACTGGACTTGCTCTACTCGAGTAGAGCAAGTCCAGTTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006818.3-1283s21c1
Sequence:CCGGGCCAGAGTTGAGTTCTATGTACTCGAGTACATAGAACTCAACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006818.3-992s21c1
Sequence:CCGGCCACCTACAAGGTCAAAGACACTCGAGTGTCTTTGACCTTGTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006818.2-459s1c1
Sequence:CCGGCCACCTACAAGGTCAAAGACACTCGAGTGTCTTTGACCTTGTAGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006818.2-750s1c1
Sequence:CCGGGCCAGAGTTGAGTTCTATGTACTCGAGTACATAGAACTCAACTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006818.2-445s1c1
Sequence:CCGGTCTGTCAGATACAGCCACCTACTCGAGTAGGTGGCTGTATCTGACAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006818.2-604s1c1
Sequence:CCGGCTTCGAACTGGACTTGCTCTACTCGAGTAGAGCAAGTCCAGTTCGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006818.2-550s1c1
Sequence:CCGGCCTTGAGTACAGCACCTTCAACTCGAGTTGAAGGTGCTGTACTCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006818.3-1083s21c1
Sequence:CCGGCCTTGAGTACAGCACCTTCAACTCGAGTTGAAGGTGCTGTACTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019914
MLLT11 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-201s1c1
Sequence:CCGGGTCAGATACACCTACCTACGACTCGAGTCGTAGGTAGGTGTATCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-198s1c1
Sequence:CCGGCCTGTCAGATACACCTACCTACTCGAGTAGGTAGGTGTATCTGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-307s1c1
Sequence:CCGGGAGTACAGCACCTTCAACTTCCTCGAGGAAGTTGAAGGTGCTGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019914.2-1245s1c1
Sequence:CCGGGCCTTTCTGTAGTTGCAGTATCTCGAGATACTGCAACTACAGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-199s1c1
Sequence:CCGGCTGTCAGATACACCTACCTACCTCGAGGTAGGTAGGTGTATCTGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-212s1c1
Sequence:CCGGCTACCTACGAGAGCAAGGATACTCGAGTATCCTTGCTCTCGTAGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019914.2-1384s1c1
Sequence:CCGGCGGAGCTGTTTATTCATTTATCTCGAGATAAATGAATAAACAGCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019914
MLLT11 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-201s1c1
Sequence:CCGGGTCAGATACACCTACCTACGACTCGAGTCGTAGGTAGGTGTATCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-198s1c1
Sequence:CCGGCCTGTCAGATACACCTACCTACTCGAGTAGGTAGGTGTATCTGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-307s1c1
Sequence:CCGGGAGTACAGCACCTTCAACTTCCTCGAGGAAGTTGAAGGTGCTGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019914.2-1245s1c1
Sequence:CCGGGCCTTTCTGTAGTTGCAGTATCTCGAGATACTGCAACTACAGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-199s1c1
Sequence:CCGGCTGTCAGATACACCTACCTACCTCGAGGTAGGTAGGTGTATCTGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-212s1c1
Sequence:CCGGCTACCTACGAGAGCAAGGATACTCGAGTATCCTTGCTCTCGTAGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019914.2-1384s1c1
Sequence:CCGGCGGAGCTGTTTATTCATTTATCTCGAGATAAATGAATAAACAGCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019914
MLLT11 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-201s1c1
Sequence:CCGGGTCAGATACACCTACCTACGACTCGAGTCGTAGGTAGGTGTATCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-198s1c1
Sequence:CCGGCCTGTCAGATACACCTACCTACTCGAGTAGGTAGGTGTATCTGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-307s1c1
Sequence:CCGGGAGTACAGCACCTTCAACTTCCTCGAGGAAGTTGAAGGTGCTGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019914.2-1245s1c1
Sequence:CCGGGCCTTTCTGTAGTTGCAGTATCTCGAGATACTGCAACTACAGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-199s1c1
Sequence:CCGGCTGTCAGATACACCTACCTACCTCGAGGTAGGTAGGTGTATCTGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019914.2-212s1c1
Sequence:CCGGCTACCTACGAGAGCAAGGATACTCGAGTATCCTTGCTCTCGTAGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019914.2-1384s1c1
Sequence:CCGGCGGAGCTGTTTATTCATTTATCTCGAGATAAATGAATAAACAGCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)