EMAIL THIS PAGE TO A FRIEND

MLLT1

myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1

55 Gene Product Result for
Synonyms: ENL LTG19 YEATS1
UniProtKB ID: Q03111, Q14768
Gene ID:
Mouse(64144) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Rat(301119) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
sheep(101110235) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
naked mole-rat(101702394) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
domestic guinea pig(100722576) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Zebrafish(565484) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
chicken(420089) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
domestic cat(101085695) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
cow(504458) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Horse(100065400) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
dog(485023) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005934 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031231 MISSION® esiRNA esiRNA targeting mouse Mllt1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005934 Rosetta Predictions human pricing
NM_001106876 Rosetta Predictions rat pricing
NM_022328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228305 predicted 1274
2 SASI_Hs01_00228306 predicted 463
3 SASI_Hs02_00340592 predicted 648
4 SASI_Hs01_00228307 predicted 723
5 SASI_Hs01_00228308 predicted 1762
6 SASI_Hs01_00228309 predicted 515
7 SASI_Hs01_00228310 predicted 2243
8 SASI_Hs01_00228311 predicted 636
9 SASI_Hs01_00228312 predicted 2202
10 SASI_Hs01_00228313 predicted 2079
11 SASI_Hs01_00228304 predicted 2290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223276 predicted 2143
2 SASI_Rn02_00223277 predicted 442
3 SASI_Rn02_00223278 predicted 1422
4 SASI_Rn02_00223279 predicted 1628
5 SASI_Rn02_00223280 predicted 2067
6 SASI_Rn02_00223281 predicted 2026
7 SASI_Rn02_00223282 predicted 2134
8 SASI_Rn02_00223283 predicted 1324
9 SASI_Rn02_00223284 predicted 2185
10 SASI_Rn02_00223285 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167570 predicted 1543
2 SASI_Mm01_00167571 predicted 359
3 SASI_Mm01_00167572 predicted 853
4 SASI_Mm01_00167573 predicted 1989
5 SASI_Mm01_00167574 predicted 1136
6 SASI_Mm01_00167575 predicted 1958
7 SASI_Mm01_00167576 predicted 1608
8 SASI_Mm01_00167577 predicted 1238
9 SASI_Mm01_00167578 predicted 852
10 SASI_Mm01_00167579 predicted 1957
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005934
VALIDATED
MLLT1 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005934.3-731s21c1
Sequence:CCGGCAAGACCTCCAAGCCACACAACTCGAGTTGTGTGGCTTGGAGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005934.3-2204s21c1
Sequence:CCGGCCTTTCTGAGCAGCGGATCGACTCGAGTCGATCCGCTGCTCAGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005934.3-585s21c1
Sequence:CCGGGTGATGGTAATGCCCGAAGGACTCGAGTCCTTCGGGCATTACCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005934.3-911s21c1
Sequence:CCGGTGCCTTCAAGGAACCCAAGATCTCGAGATCTTGGGTTCCTTGAAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-284s1c1
Sequence:CCGGGCAATGTGACATCCAGCACTTCTCGAGAAGTGCTGGATGTCACATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-1607s1c1
Sequence:CCGGGCCTGAGAAGATCCTCAAGAACTCGAGTTCTTGAGGATCTTCTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-521s1c1
Sequence:CCGGCGAGAAGCTCACCTTCAACAACTCGAGTTGTTGAAGGTGAGCTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-1712s1c1
Sequence:CCGGGCAGATTGTGAATCTGATCGACTCGAGTCGATCAGATTCACAATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-398s1c1
Sequence:CCGGCGCTGGCTTCATCATGCCCATCTCGAGATGGGCATGATGAAGCCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005934
VALIDATED
MLLT1 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005934.3-731s21c1
Sequence:CCGGCAAGACCTCCAAGCCACACAACTCGAGTTGTGTGGCTTGGAGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005934.3-2204s21c1
Sequence:CCGGCCTTTCTGAGCAGCGGATCGACTCGAGTCGATCCGCTGCTCAGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005934.3-585s21c1
Sequence:CCGGGTGATGGTAATGCCCGAAGGACTCGAGTCCTTCGGGCATTACCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005934.3-911s21c1
Sequence:CCGGTGCCTTCAAGGAACCCAAGATCTCGAGATCTTGGGTTCCTTGAAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-284s1c1
Sequence:CCGGGCAATGTGACATCCAGCACTTCTCGAGAAGTGCTGGATGTCACATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-1607s1c1
Sequence:CCGGGCCTGAGAAGATCCTCAAGAACTCGAGTTCTTGAGGATCTTCTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-521s1c1
Sequence:CCGGCGAGAAGCTCACCTTCAACAACTCGAGTTGTTGAAGGTGAGCTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-1712s1c1
Sequence:CCGGGCAGATTGTGAATCTGATCGACTCGAGTCGATCAGATTCACAATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-398s1c1
Sequence:CCGGCGCTGGCTTCATCATGCCCATCTCGAGATGGGCATGATGAAGCCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005934
VALIDATED
MLLT1 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005934.3-731s21c1
Sequence:CCGGCAAGACCTCCAAGCCACACAACTCGAGTTGTGTGGCTTGGAGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005934.3-2204s21c1
Sequence:CCGGCCTTTCTGAGCAGCGGATCGACTCGAGTCGATCCGCTGCTCAGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005934.3-585s21c1
Sequence:CCGGGTGATGGTAATGCCCGAAGGACTCGAGTCCTTCGGGCATTACCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005934.3-911s21c1
Sequence:CCGGTGCCTTCAAGGAACCCAAGATCTCGAGATCTTGGGTTCCTTGAAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-284s1c1
Sequence:CCGGGCAATGTGACATCCAGCACTTCTCGAGAAGTGCTGGATGTCACATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-1607s1c1
Sequence:CCGGGCCTGAGAAGATCCTCAAGAACTCGAGTTCTTGAGGATCTTCTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-521s1c1
Sequence:CCGGCGAGAAGCTCACCTTCAACAACTCGAGTTGTTGAAGGTGAGCTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-1712s1c1
Sequence:CCGGGCAGATTGTGAATCTGATCGACTCGAGTCGATCAGATTCACAATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005934.2-398s1c1
Sequence:CCGGCGCTGGCTTCATCATGCCCATCTCGAGATGGGCATGATGAAGCCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022328
VALIDATED
MLLT1 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-364s21c1
Sequence:CCGGCTCATTGAAGTGTACTTCAAACTCGAGTTTGAAGTACACTTCAATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-861s21c1
Sequence:CCGGGATGGCCCTAAAGGAAACCAACTCGAGTTGGTTTCCTTTAGGGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-349s21c1
Sequence:CCGGGCAGGCTTCATCATGCTCATTCTCGAGAATGAGCATGATGAAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-1536s21c1
Sequence:CCGGGAAGAAGGCTACCTATGACAACTCGAGTTGTCATAGGTAGCCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-2631s1c1
Sequence:CCGGCCAACTTCAGTTGTCGGTGTTCTCGAGAACACCGACAACTGAAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-364s1c1
Sequence:CCGGCTCATTGAAGTGTACTTCAAACTCGAGTTTGAAGTACACTTCAATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-1536s1c1
Sequence:CCGGGAAGAAGGCTACCTATGACAACTCGAGTTGTCATAGGTAGCCTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-861s1c1
Sequence:CCGGGATGGCCCTAAAGGAAACCAACTCGAGTTGGTTTCCTTTAGGGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-349s1c1
Sequence:CCGGGCAGGCTTCATCATGCTCATTCTCGAGAATGAGCATGATGAAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022328
VALIDATED
MLLT1 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-364s21c1
Sequence:CCGGCTCATTGAAGTGTACTTCAAACTCGAGTTTGAAGTACACTTCAATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-861s21c1
Sequence:CCGGGATGGCCCTAAAGGAAACCAACTCGAGTTGGTTTCCTTTAGGGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-349s21c1
Sequence:CCGGGCAGGCTTCATCATGCTCATTCTCGAGAATGAGCATGATGAAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-1536s21c1
Sequence:CCGGGAAGAAGGCTACCTATGACAACTCGAGTTGTCATAGGTAGCCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-2631s1c1
Sequence:CCGGCCAACTTCAGTTGTCGGTGTTCTCGAGAACACCGACAACTGAAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-364s1c1
Sequence:CCGGCTCATTGAAGTGTACTTCAAACTCGAGTTTGAAGTACACTTCAATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-1536s1c1
Sequence:CCGGGAAGAAGGCTACCTATGACAACTCGAGTTGTCATAGGTAGCCTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-861s1c1
Sequence:CCGGGATGGCCCTAAAGGAAACCAACTCGAGTTGGTTTCCTTTAGGGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-349s1c1
Sequence:CCGGGCAGGCTTCATCATGCTCATTCTCGAGAATGAGCATGATGAAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022328
VALIDATED
MLLT1 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-364s21c1
Sequence:CCGGCTCATTGAAGTGTACTTCAAACTCGAGTTTGAAGTACACTTCAATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-861s21c1
Sequence:CCGGGATGGCCCTAAAGGAAACCAACTCGAGTTGGTTTCCTTTAGGGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-349s21c1
Sequence:CCGGGCAGGCTTCATCATGCTCATTCTCGAGAATGAGCATGATGAAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022328.2-1536s21c1
Sequence:CCGGGAAGAAGGCTACCTATGACAACTCGAGTTGTCATAGGTAGCCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-2631s1c1
Sequence:CCGGCCAACTTCAGTTGTCGGTGTTCTCGAGAACACCGACAACTGAAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-364s1c1
Sequence:CCGGCTCATTGAAGTGTACTTCAAACTCGAGTTTGAAGTACACTTCAATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-1536s1c1
Sequence:CCGGGAAGAAGGCTACCTATGACAACTCGAGTTGTCATAGGTAGCCTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-861s1c1
Sequence:CCGGGATGGCCCTAAAGGAAACCAACTCGAGTTGGTTTCCTTTAGGGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022328.2-349s1c1
Sequence:CCGGGCAGGCTTCATCATGCTCATTCTCGAGAATGAGCATGATGAAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)