EMAIL THIS PAGE TO A FRIEND

MLLT3

myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3

193 Gene Product Result for
Synonyms: AF9 YEATS3
UniProtKB ID: P42568, B1AMQ2, D3DRJ8
Gene ID:
Mouse(70122) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
Rat(114510) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
domestic guinea pig(100735008) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
sheep(101102874) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
Zebrafish(550517) myeloid/lymphoid or mixed lineage-leukemia translocation to 3 homolog (Drosophila)
cow(521962) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
chicken(427234) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
domestic cat(101083553) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
dog(481556) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004529 Rosetta Predictions human pricing
NM_053718 Rosetta Predictions rat pricing
XM_579573 Rosetta Predictions rat pricing
NM_027326 Rosetta Predictions mouse pricing
NM_029931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142501 predicted 1543
2 SASI_Hs01_00142502 predicted 1457
3 SASI_Hs01_00142503 predicted 1510
4 SASI_Hs01_00142505 predicted 1697
5 SASI_Hs01_00142506 predicted 460
6 SASI_Hs01_00142507 predicted 1360
7 SASI_Hs01_00142508 predicted 1470
8 SASI_Hs01_00142509 predicted 447
9 SASI_Hs02_00337826 predicted 1453
10 SASI_Hs01_00142510 predicted 1746
11 SASI_Hs01_00142504 predicted 1619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084313 predicted 1159
2 SASI_Rn01_00084314 predicted 1224
3 SASI_Rn01_00084315 predicted 936
4 SASI_Rn01_00084316 predicted 1197
5 SASI_Rn01_00084319 predicted 935
6 SASI_Rn01_00084320 predicted 1012
7 SASI_Rn01_00084321 predicted 942
8 SASI_Rn01_00084322 predicted 1061
9 SASI_Rn02_00266481 predicted 942
10 SASI_Rn02_00266482 predicted 960
11 SASI_Rn01_00084317 predicted 1221
12 SASI_Rn01_00084318 predicted 1259
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145546 predicted 367
2 SASI_Rn01_00145547 predicted 369
3 SASI_Rn01_00145548 predicted 383
4 SASI_Rn01_00145549 predicted 390
5 SASI_Rn01_00145550 predicted 380
6 SASI_Rn01_00145551 predicted 305
7 SASI_Rn01_00145552 predicted 304
8 SASI_Rn01_00145553 predicted 301
9 SASI_Rn01_00145554 predicted 339
10 SASI_Rn01_00145555 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116457 predicted 2372
2 SASI_Mm01_00116459 predicted 1799
3 SASI_Mm02_00331957 predicted 2009
4 SASI_Mm02_00331958 predicted 428
5 SASI_Mm02_00331959 predicted 594
6 SASI_Mm02_00331960 predicted 1900
7 SASI_Mm01_00116462 predicted 1529
8 SASI_Mm01_00116463 predicted 1514
9 SASI_Mm02_00331961 predicted 1782
10 SASI_Mm02_00331962 predicted 957
11 SASI_Mm01_00116458 predicted 2222
12 SASI_Mm01_00116460 predicted 361
13 SASI_Mm01_00116461 predicted 1622
14 SASI_Mm01_00116464 predicted 2347
15 SASI_Mm01_00116465 predicted 1255
16 SASI_Mm01_00116466 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173046 predicted 1034
2 SASI_Mm02_00336211 predicted 459
3 SASI_Mm01_00173050 predicted 574
4 SASI_Mm01_00173051 predicted 670
5 SASI_Mm01_00173052 predicted 572
6 SASI_Mm01_00173053 predicted 653
7 SASI_Mm01_00173055 predicted 568
8 SASI_Mm02_00336212 predicted 435
9 SASI_Mm02_00336213 predicted 455
10 SASI_Mm01_00173048 predicted 264
11 SASI_Mm01_00173047 predicted 1104
12 SASI_Mm01_00173049 predicted 1012
13 SASI_Mm01_00173054 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004529
VALIDATED
MLLT3 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004529.2-3005s21c1
Sequence:CCGGGCCAGTGTGTTACTCATCTTTCTCGAGAAAGATGAGTAACACACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004529.1-2942s1c1
Sequence:CCGGGCCAGTGTGTTACTCATCTTTCTCGAGAAAGATGAGTAACACACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004529.1-315s1c1
Sequence:CCGGGCACAGTAACATACAGCACTTCTCGAGAAGTGCTGTATGTTACTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004529.1-1255s1c1
Sequence:CCGGCCATTTGATGATATTGTGGATCTCGAGATCCACAATATCATCAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004529.1-1699s1c1
Sequence:CCGGGCATACCTAGATGAACTGGTACTCGAGTACCAGTTCATCTAGGTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004529.1-890s1c1
Sequence:CCGGCCTCTAAGAAACCCAAAGAAACTCGAGTTTCTTTGGGTTTCTTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004529.2-379s21c1
Sequence:CCGGGCACAGTAACATACAGCACTTCTCGAGAAGTGCTGTATGTTACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004529.2-1763s21c1
Sequence:CCGGGCATACCTAGATGAACTGGTACTCGAGTACCAGTTCATCTAGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004529.2-954s21c1
Sequence:CCGGCCTCTAAGAAACCCAAAGAAACTCGAGTTTCTTTGGGTTTCTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004529
VALIDATED
MLLT3 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004529.2-3005s21c1
Sequence:CCGGGCCAGTGTGTTACTCATCTTTCTCGAGAAAGATGAGTAACACACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004529.1-2942s1c1
Sequence:CCGGGCCAGTGTGTTACTCATCTTTCTCGAGAAAGATGAGTAACACACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004529.1-315s1c1
Sequence:CCGGGCACAGTAACATACAGCACTTCTCGAGAAGTGCTGTATGTTACTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004529.1-1255s1c1
Sequence:CCGGCCATTTGATGATATTGTGGATCTCGAGATCCACAATATCATCAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004529.1-1699s1c1
Sequence:CCGGGCATACCTAGATGAACTGGTACTCGAGTACCAGTTCATCTAGGTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004529.1-890s1c1
Sequence:CCGGCCTCTAAGAAACCCAAAGAAACTCGAGTTTCTTTGGGTTTCTTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004529.2-379s21c1
Sequence:CCGGGCACAGTAACATACAGCACTTCTCGAGAAGTGCTGTATGTTACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004529.2-1763s21c1
Sequence:CCGGGCATACCTAGATGAACTGGTACTCGAGTACCAGTTCATCTAGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004529.2-954s21c1
Sequence:CCGGCCTCTAAGAAACCCAAAGAAACTCGAGTTTCTTTGGGTTTCTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004529
VALIDATED
MLLT3 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004529.2-3005s21c1
Sequence:CCGGGCCAGTGTGTTACTCATCTTTCTCGAGAAAGATGAGTAACACACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005790    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004529.1-2942s1c1
Sequence:CCGGGCCAGTGTGTTACTCATCTTTCTCGAGAAAGATGAGTAACACACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004529.1-315s1c1
Sequence:CCGGGCACAGTAACATACAGCACTTCTCGAGAAGTGCTGTATGTTACTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004529.1-1255s1c1
Sequence:CCGGCCATTTGATGATATTGTGGATCTCGAGATCCACAATATCATCAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004529.1-1699s1c1
Sequence:CCGGGCATACCTAGATGAACTGGTACTCGAGTACCAGTTCATCTAGGTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_004529.1-890s1c1
Sequence:CCGGCCTCTAAGAAACCCAAAGAAACTCGAGTTTCTTTGGGTTTCTTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004529.2-379s21c1
Sequence:CCGGGCACAGTAACATACAGCACTTCTCGAGAAGTGCTGTATGTTACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004529.2-1763s21c1
Sequence:CCGGGCATACCTAGATGAACTGGTACTCGAGTACCAGTTCATCTAGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004529.2-954s21c1
Sequence:CCGGCCTCTAAGAAACCCAAAGAAACTCGAGTTTCTTTGGGTTTCTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027326
VALIDATED
MLLT3 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027326.2-2011s1c1
Sequence:CCGGCCAGTCATCATCTCTTGATAACTCGAGTTATCAAGAGATGATGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027326.2-538s1c1
Sequence:CCGGCCGCTGTGAGAAACTAACTTTCTCGAGAAAGTTAGTTTCTCACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027326.2-421s1c1
Sequence:CCGGCGCTGGCTTCATATTGCCAATCTCGAGATTGGCAATATGAAGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027326.2-481s1c1
Sequence:CCGGCCGCTTTGATTATGACTTATTCTCGAGAATAAGTCATAATCAAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027326.2-1440s1c1
Sequence:CCGGCGGAGATGGAAAGACCTGTAACTCGAGTTACAGGTCTTTCCATCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027326
VALIDATED
MLLT3 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027326.2-2011s1c1
Sequence:CCGGCCAGTCATCATCTCTTGATAACTCGAGTTATCAAGAGATGATGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027326.2-538s1c1
Sequence:CCGGCCGCTGTGAGAAACTAACTTTCTCGAGAAAGTTAGTTTCTCACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027326.2-421s1c1
Sequence:CCGGCGCTGGCTTCATATTGCCAATCTCGAGATTGGCAATATGAAGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027326.2-481s1c1
Sequence:CCGGCCGCTTTGATTATGACTTATTCTCGAGAATAAGTCATAATCAAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027326.2-1440s1c1
Sequence:CCGGCGGAGATGGAAAGACCTGTAACTCGAGTTACAGGTCTTTCCATCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027326
VALIDATED
MLLT3 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027326.2-2011s1c1
Sequence:CCGGCCAGTCATCATCTCTTGATAACTCGAGTTATCAAGAGATGATGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027326.2-538s1c1
Sequence:CCGGCCGCTGTGAGAAACTAACTTTCTCGAGAAAGTTAGTTTCTCACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027326.2-421s1c1
Sequence:CCGGCGCTGGCTTCATATTGCCAATCTCGAGATTGGCAATATGAAGCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027326.2-481s1c1
Sequence:CCGGCCGCTTTGATTATGACTTATTCTCGAGAATAAGTCATAATCAAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027326.2-1440s1c1
Sequence:CCGGCGGAGATGGAAAGACCTGTAACTCGAGTTACAGGTCTTTCCATCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)