EMAIL THIS PAGE TO A FRIEND

MLLT4

myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4

176 Gene Product Result for
Synonyms: AF6 RP3-431P23.3
Gene ID:
Human(4301) Summary: This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
Mouse(17356) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Rat(26955) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Zebrafish(558359) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
cow(504856) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Horse(100054846) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
domestic cat(101081386) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
dog(431695) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
chicken(421564) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
sheep(101115800) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
domestic guinea pig(100720687) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
naked mole-rat(101702949) myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A0349 Anti-l-Afadin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, canine, mouse, rat
immunofluorescence, immunohistochemistry, microarray, western blot pricing
A0224 Anti-l/s-Afadin antibody produced in rabbit affinity isolated antibody rat, canine, mouse, human
immunocytochemistry, immunofluorescence, immunohistochemistry, microarray, western blot pricing
AV34225 Anti-MLLT4 antibody produced in rabbit IgG fraction of antiserum rabbit, human, rat, guinea pig, horse, mouse
western blot pricing
HPA030212 Anti-MLLT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunofluorescence, immunohistochemistry pricing
HPA030213 Anti-MLLT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA030214 Anti-MLLT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 human
immunohistochemistry pricing
HPA030215 Anti-MLLT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab4 human
immunofluorescence, immunohistochemistry pricing
HPA049868 Anti-MLLT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0057 AQUA Peptide ERQRLF(pS)QGQDVSN[K] chicken, dog, human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005936 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_139743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_139743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_139743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040000 Rosetta Predictions human pricing
NM_001040001 Rosetta Predictions human pricing
NM_005936 Rosetta Predictions human pricing
NM_013217 Rosetta Predictions rat pricing
NM_010806 Rosetta Predictions mouse pricing
XM_890447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308740 predicted 961
2 SASI_Hs01_00243266 predicted 871
3 SASI_Hs01_00243267 predicted 3028
4 SASI_Hs02_00308741 predicted 1932
5 SASI_Hs01_00243269 predicted 1687
6 SASI_Hs02_00308742 predicted 3059
7 SASI_Hs01_00243270 predicted 2120
8 SASI_Hs01_00243271 predicted 3240
9 SASI_Hs01_00243272 predicted 4038
10 SASI_Hs01_00243273 predicted 3996
11 SASI_Hs01_00243265 predicted 3533
12 SASI_Hs01_00243268 predicted 2708
13 SASI_Hs01_00243274 predicted 2223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308743 predicted 954
2 SASI_Hs01_00233992 predicted 863
3 SASI_Hs01_00233993 predicted 3028
4 SASI_Hs02_00308744 predicted 1932
5 SASI_Hs01_00233995 predicted 1692
6 SASI_Hs02_00308745 predicted 3059
7 SASI_Hs01_00233996 predicted 2118
8 SASI_Hs01_00233997 predicted 3238
9 SASI_Hs01_00233998 predicted 4038
10 SASI_Hs01_00233999 predicted 3990
11 SASI_Hs01_00233991 predicted 3534
12 SASI_Hs01_00233994 predicted 2714
13 SASI_Hs01_00234000 predicted 2228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340594 predicted 958
2 SASI_Hs01_00178516 predicted 867
3 SASI_Hs01_00178517 predicted 2982
4 SASI_Hs02_00340595 predicted 1888
5 SASI_Hs01_00178519 predicted 1648
6 SASI_Hs02_00340596 predicted 3009
7 SASI_Hs01_00178520 predicted 2074
8 SASI_Hs01_00178521 predicted 3193
9 SASI_Hs01_00178522 predicted 3992
10 SASI_Hs01_00178523 predicted 3943
11 SASI_Hs01_00178515 predicted 3481
12 SASI_Hs01_00178518 predicted 2664
13 SASI_Hs01_00178524 predicted 2179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119895 predicted 2888
2 SASI_Rn01_00119896 predicted 5295
3 SASI_Rn01_00119898 predicted 2219
4 SASI_Rn01_00119899 predicted 1900
5 SASI_Rn01_00119900 predicted 5595
6 SASI_Rn01_00119901 predicted 3159
7 SASI_Rn01_00119902 predicted 1782
8 SASI_Rn01_00119903 predicted 1560
9 SASI_Rn01_00119904 predicted 589
10 SASI_Rn02_00261080 predicted 3727
11 SASI_Rn01_00119897 predicted 3451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319382 predicted 3090
2 SASI_Mm02_00319383 predicted 4033
3 SASI_Mm02_00319384 predicted 1070
4 SASI_Mm02_00319385 predicted 5090
5 SASI_Mm02_00319386 predicted 953
6 SASI_Mm02_00319387 predicted 1869
7 SASI_Mm02_00319388 predicted 2945
8 SASI_Mm02_00319389 predicted 1590
9 SASI_Mm02_00319390 predicted 3261
10 SASI_Mm02_00319391 predicted 4829
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261480 predicted 3128
2 SASI_Mm01_00261481 predicted 1085
3 SASI_Mm01_00261482 predicted 5112
4 SASI_Mm01_00261483 predicted 962
5 SASI_Mm01_00261484 predicted 2034
6 SASI_Mm01_00261485 predicted 2973
7 SASI_Mm01_00261486 predicted 1604
8 SASI_Mm01_00261487 predicted 3290
9 SASI_Mm01_00261488 predicted 2673
10 SASI_Mm01_00261489 predicted 3551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005936
VALIDATED
MLLT4 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-2630s21c1
Sequence:CCGGATCGTGCAGGCAACGACTTTGCTCGAGCAAAGTCGTTGCCTGCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-2772s21c1
Sequence:CCGGTTATCCCAACGGATCTTATAGCTCGAGCTATAAGATCCGTTGGGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-1289s21c1
Sequence:CCGGCTGCCCTATTTAGTAGAGTTACTCGAGTAACTCTACTAAATAGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-3554s21c1
Sequence:CCGGCCAAAGAAATTGCCTGGTGATCTCGAGATCACCAGGCAATTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-3961s21c1
Sequence:CCGGGCATCGAATAGAGGCAGCTATCTCGAGATAGCTGCCTCTATTCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-1147s1c1
Sequence:CCGGCTGCCCTATTTAGTAGAGTTACTCGAGTAACTCTACTAAATAGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-3819s1c1
Sequence:CCGGGCATCGAATAGAGGCAGCTATCTCGAGATAGCTGCCTCTATTCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-3412s1c1
Sequence:CCGGCCAAAGAAATTGCCTGGTGATCTCGAGATCACCAGGCAATTTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-1429s1c1
Sequence:CCGGGCGTCCCATGTATTTAAGTTTCTCGAGAAACTTAAATACATGGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005936
VALIDATED
MLLT4 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-2630s21c1
Sequence:CCGGATCGTGCAGGCAACGACTTTGCTCGAGCAAAGTCGTTGCCTGCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-2772s21c1
Sequence:CCGGTTATCCCAACGGATCTTATAGCTCGAGCTATAAGATCCGTTGGGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-1289s21c1
Sequence:CCGGCTGCCCTATTTAGTAGAGTTACTCGAGTAACTCTACTAAATAGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-3554s21c1
Sequence:CCGGCCAAAGAAATTGCCTGGTGATCTCGAGATCACCAGGCAATTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-3961s21c1
Sequence:CCGGGCATCGAATAGAGGCAGCTATCTCGAGATAGCTGCCTCTATTCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-1147s1c1
Sequence:CCGGCTGCCCTATTTAGTAGAGTTACTCGAGTAACTCTACTAAATAGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-3819s1c1
Sequence:CCGGGCATCGAATAGAGGCAGCTATCTCGAGATAGCTGCCTCTATTCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-3412s1c1
Sequence:CCGGCCAAAGAAATTGCCTGGTGATCTCGAGATCACCAGGCAATTTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-1429s1c1
Sequence:CCGGGCGTCCCATGTATTTAAGTTTCTCGAGAAACTTAAATACATGGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005936
VALIDATED
MLLT4 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-2630s21c1
Sequence:CCGGATCGTGCAGGCAACGACTTTGCTCGAGCAAAGTCGTTGCCTGCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-2772s21c1
Sequence:CCGGTTATCCCAACGGATCTTATAGCTCGAGCTATAAGATCCGTTGGGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-1289s21c1
Sequence:CCGGCTGCCCTATTTAGTAGAGTTACTCGAGTAACTCTACTAAATAGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-3554s21c1
Sequence:CCGGCCAAAGAAATTGCCTGGTGATCTCGAGATCACCAGGCAATTTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005936.2-3961s21c1
Sequence:CCGGGCATCGAATAGAGGCAGCTATCTCGAGATAGCTGCCTCTATTCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-1147s1c1
Sequence:CCGGCTGCCCTATTTAGTAGAGTTACTCGAGTAACTCTACTAAATAGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-3819s1c1
Sequence:CCGGGCATCGAATAGAGGCAGCTATCTCGAGATAGCTGCCTCTATTCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-3412s1c1
Sequence:CCGGCCAAAGAAATTGCCTGGTGATCTCGAGATCACCAGGCAATTTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005936.1-1429s1c1
Sequence:CCGGGCGTCCCATGTATTTAAGTTTCTCGAGAAACTTAAATACATGGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_139743
VALIDATED
MLLT4 MISSION shRNA Bacterial Glycerol Stock
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139743.6-4369s1c1
Sequence:CCGGGATCTGAACATCAGAAGGCAACTCGAGTTGCCTTCTGATGTTCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139743.6-379s1c1
Sequence:CCGGGAAAGAAGATTGGACATTGATCTCGAGATCAATGTCCAATCTTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_139743.6-2344s1c1
Sequence:CCGGCCTGAGGAGAACAGTCTGCAACTCGAGTTGCAGACTGTTCTCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_139743.6-5716s1c1
Sequence:CCGGCGAAACGCATCCTACCTCAAACTCGAGTTTGAGGTAGGATGCGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139743.6-958s1c1
Sequence:CCGGGCCGAATCTTTGGAGAAGTATCTCGAGATACTTCTCCAAAGATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_139743
VALIDATED
MLLT4 MISSION shRNA shRNA Plasmid DNA
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139743.6-4369s1c1
Sequence:CCGGGATCTGAACATCAGAAGGCAACTCGAGTTGCCTTCTGATGTTCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139743.6-379s1c1
Sequence:CCGGGAAAGAAGATTGGACATTGATCTCGAGATCAATGTCCAATCTTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_139743.6-2344s1c1
Sequence:CCGGCCTGAGGAGAACAGTCTGCAACTCGAGTTGCAGACTGTTCTCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_139743.6-5716s1c1
Sequence:CCGGCGAAACGCATCCTACCTCAAACTCGAGTTTGAGGTAGGATGCGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139743.6-958s1c1
Sequence:CCGGGCCGAATCTTTGGAGAAGTATCTCGAGATACTTCTCCAAAGATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_139743
VALIDATED
MLLT4 MISSION shRNA Lentiviral Transduction Particles
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139743.6-4369s1c1
Sequence:CCGGGATCTGAACATCAGAAGGCAACTCGAGTTGCCTTCTGATGTTCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139743.6-379s1c1
Sequence:CCGGGAAAGAAGATTGGACATTGATCTCGAGATCAATGTCCAATCTTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_139743.6-2344s1c1
Sequence:CCGGCCTGAGGAGAACAGTCTGCAACTCGAGTTGCAGACTGTTCTCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_139743.6-5716s1c1
Sequence:CCGGCGAAACGCATCCTACCTCAAACTCGAGTTTGAGGTAGGATGCGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139743.6-958s1c1
Sequence:CCGGGCCGAATCTTTGGAGAAGTATCTCGAGATACTTCTCCAAAGATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)