EMAIL THIS PAGE TO A FRIEND

MLN

motilin

44 Gene Product Result for
Gene ID:
Human(4295) Summary: This gene encodes a small peptide hormone that is secreted by cells of the small intestine to regulate gastrointestinal contractions and motility. Proteolytic processing of the secreted protein produces the mature peptide and a byproduct referred to as motilin-associated peptide (MAP). Three transcript variants encoding different preproprotein isoforms but the same mature peptide have been found for this gene. [provided by RefSeq, May 2010]
Rat(100126231) motilin
sheep(443473) motilin
chicken(768422) motilin
cow(280860) motilin
dog(481748) motilin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040109 Rosetta Predictions human pricing
NM_002418 Rosetta Predictions human pricing
NM_001110056 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071494 predicted 219
2 SASI_Hs01_00071495 predicted 263
3 SASI_Hs01_00071496 predicted 295
4 SASI_Hs01_00071497 predicted 301
5 SASI_Hs01_00071499 predicted 334
6 SASI_Hs01_00071500 predicted 218
7 SASI_Hs01_00071501 predicted 307
8 SASI_Hs01_00071502 predicted 310
9 SASI_Hs02_00308833 predicted 319
10 SASI_Hs02_00308834 predicted 294
11 SASI_Hs01_00071493 predicted 311
12 SASI_Hs01_00071498 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189049 predicted 217
2 SASI_Hs01_00189050 predicted 257
3 SASI_Hs01_00189051 predicted 301
4 SASI_Hs01_00189052 predicted 301
5 SASI_Hs01_00189054 predicted 331
6 SASI_Hs01_00189055 predicted 223
7 SASI_Hs01_00189056 predicted 302
8 SASI_Hs01_00189057 predicted 310
9 SASI_Hs02_00333809 predicted 320
10 SASI_Hs02_00333810 predicted 288
11 SASI_Hs01_00189048 predicted 309
12 SASI_Hs01_00189053 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250992 predicted 129
2 SASI_Rn02_00250993 predicted 43
3 SASI_Rn02_00250994 predicted 51
4 SASI_Rn02_00250995 predicted 82
5 SASI_Rn02_00250996 predicted 114
6 SASI_Rn02_00250997 predicted 54
7 SASI_Rn02_00250998 predicted 42
8 SASI_Rn02_00250999 predicted 80
9 SASI_Rn02_00251000 predicted 94
10 SASI_Rn02_00251001 predicted 55
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002418
MLN MISSION shRNA Bacterial Glycerol Stock
motilin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-193s1c1
Sequence:CCGGAGGAACGGAATAAAGGGCAAACTCGAGTTTGCCCTTTATTCCGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-310s1c1
Sequence:CCGGCTGCTCCTCTGGAAATTGGAACTCGAGTTCCAATTTCCAGAGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-163s1c1
Sequence:CCGGCCTATGGCGAACTCCAGAGGACTCGAGTCCTCTGGAGTTCGCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-220s1c1
Sequence:CCGGCCCTGAGTGTATGGCAGAGGTCTCGAGACCTCTGCCATACACTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-400s21c1
Sequence:CCGGCCCAGCATGCAGCCAAGTGATCTCGAGATCACTTGGCTGCATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-333s21c1
Sequence:CCGGAGGATGAACTCCAGACAGCTGCTCGAGCAGCTGTCTGGAGTTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-321s21c1
Sequence:CCGGGAAATTGGAATGAGGATGAACCTCGAGGTTCATCCTCATTCCAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-292s21c1
Sequence:CCGGACGAAATGATCAAGCTGACTGCTCGAGCAGTCAGCTTGATCATTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002418
MLN MISSION shRNA shRNA Plasmid DNA
motilin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-193s1c1
Sequence:CCGGAGGAACGGAATAAAGGGCAAACTCGAGTTTGCCCTTTATTCCGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-310s1c1
Sequence:CCGGCTGCTCCTCTGGAAATTGGAACTCGAGTTCCAATTTCCAGAGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-163s1c1
Sequence:CCGGCCTATGGCGAACTCCAGAGGACTCGAGTCCTCTGGAGTTCGCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-220s1c1
Sequence:CCGGCCCTGAGTGTATGGCAGAGGTCTCGAGACCTCTGCCATACACTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-400s21c1
Sequence:CCGGCCCAGCATGCAGCCAAGTGATCTCGAGATCACTTGGCTGCATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-333s21c1
Sequence:CCGGAGGATGAACTCCAGACAGCTGCTCGAGCAGCTGTCTGGAGTTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-321s21c1
Sequence:CCGGGAAATTGGAATGAGGATGAACCTCGAGGTTCATCCTCATTCCAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-292s21c1
Sequence:CCGGACGAAATGATCAAGCTGACTGCTCGAGCAGTCAGCTTGATCATTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002418
MLN MISSION shRNA Lentiviral Transduction Particles
motilin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-193s1c1
Sequence:CCGGAGGAACGGAATAAAGGGCAAACTCGAGTTTGCCCTTTATTCCGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-310s1c1
Sequence:CCGGCTGCTCCTCTGGAAATTGGAACTCGAGTTCCAATTTCCAGAGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-163s1c1
Sequence:CCGGCCTATGGCGAACTCCAGAGGACTCGAGTCCTCTGGAGTTCGCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002418.1-220s1c1
Sequence:CCGGCCCTGAGTGTATGGCAGAGGTCTCGAGACCTCTGCCATACACTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-400s21c1
Sequence:CCGGCCCAGCATGCAGCCAAGTGATCTCGAGATCACTTGGCTGCATGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-333s21c1
Sequence:CCGGAGGATGAACTCCAGACAGCTGCTCGAGCAGCTGTCTGGAGTTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-321s21c1
Sequence:CCGGGAAATTGGAATGAGGATGAACCTCGAGGTTCATCCTCATTCCAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002418.2-292s21c1
Sequence:CCGGACGAAATGATCAAGCTGACTGCTCGAGCAGTCAGCTTGATCATTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)