EMAIL THIS PAGE TO A FRIEND

MLNR

motilin receptor

27 Gene Product Result for
Synonyms: GPR38 MTLR1
UniProtKB ID: O43193
Gene ID:
Human(2862) Summary: Motilin is a 22 amino acid peptide hormone expressed throughout the gastrointestinal (GI) tract. The protein encoded by this gene is a motilin receptor which is a member of the G-protein coupled receptor 1 family. This member is a multi-pass transmembrane protein, and is an important therapeutic target for the treatment of hypomotility disorders. [provided by RefSeq, Aug 2011]
chicken(428072) motilin receptor
cow(541212) motilin receptor
cow(788867) motilin receptor
dog(608252) motilin receptor
domestic cat(101100612) motilin receptor
naked mole-rat(101699429) motilin receptor
sheep(101105340) motilin receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001507 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001507 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205471 predicted 975
2 SASI_Hs01_00205472 predicted 961
3 SASI_Hs01_00205473 predicted 942
4 SASI_Hs01_00205474 predicted 941
5 SASI_Hs01_00205476 predicted 198
6 SASI_Hs01_00205477 predicted 933
7 SASI_Hs01_00205478 predicted 901
8 SASI_Hs02_00331999 predicted 901
9 SASI_Hs01_00205479 predicted 746
10 SASI_Hs01_00205480 predicted 793
11 SASI_Hs01_00205475 predicted 760
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001507
MLNR MISSION shRNA Bacterial Glycerol Stock
motilin receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-943s21c1
Sequence:CCGGCACGTTGGCAGAATCATTTACCTCGAGGTAAATGATTCTGCCAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-991s21c1
Sequence:CCGGTACTTCTCTCAGTACTTTAACCTCGAGGTTAAAGTACTGAGAGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-969s21c1
Sequence:CCGGCACGGAAGATTCGCGGATGATCTCGAGATCATCCGCGAATCTTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-1054s1c1
Sequence:CCGGCCAATCCTCTACAACCTCATTCTCGAGAATGAGGTTGTAGAGGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-1038s1c1
Sequence:CCGGGAGCGCATCTATCAACCCAATCTCGAGATTGGGTTGATAGATGCGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-683s1c1
Sequence:CCGGCGGCGCTGTTCAGCCGCGAATCTCGAGATTCGCGGCTGAACAGCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-1030s21c1
Sequence:CCGGTTCTATCTGAGCGCATCTATCCTCGAGGATAGATGCGCTCAGATAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-1059s1c1
Sequence:CCGGCCTCTACAACCTCATTTCAAACTCGAGTTTGAAATGAGGTTGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-939s1c1
Sequence:CCGGCTTCCACGTTGGCAGAATCATCTCGAGATGATTCTGCCAACGTGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001507
MLNR MISSION shRNA shRNA Plasmid DNA
motilin receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-943s21c1
Sequence:CCGGCACGTTGGCAGAATCATTTACCTCGAGGTAAATGATTCTGCCAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-991s21c1
Sequence:CCGGTACTTCTCTCAGTACTTTAACCTCGAGGTTAAAGTACTGAGAGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-969s21c1
Sequence:CCGGCACGGAAGATTCGCGGATGATCTCGAGATCATCCGCGAATCTTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-1054s1c1
Sequence:CCGGCCAATCCTCTACAACCTCATTCTCGAGAATGAGGTTGTAGAGGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-1038s1c1
Sequence:CCGGGAGCGCATCTATCAACCCAATCTCGAGATTGGGTTGATAGATGCGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-683s1c1
Sequence:CCGGCGGCGCTGTTCAGCCGCGAATCTCGAGATTCGCGGCTGAACAGCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-1030s21c1
Sequence:CCGGTTCTATCTGAGCGCATCTATCCTCGAGGATAGATGCGCTCAGATAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-1059s1c1
Sequence:CCGGCCTCTACAACCTCATTTCAAACTCGAGTTTGAAATGAGGTTGTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-939s1c1
Sequence:CCGGCTTCCACGTTGGCAGAATCATCTCGAGATGATTCTGCCAACGTGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001507
MLNR MISSION shRNA Lentiviral Transduction Particles
motilin receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-943s21c1
Sequence:CCGGCACGTTGGCAGAATCATTTACCTCGAGGTAAATGATTCTGCCAACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-991s21c1
Sequence:CCGGTACTTCTCTCAGTACTTTAACCTCGAGGTTAAAGTACTGAGAGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-969s21c1
Sequence:CCGGCACGGAAGATTCGCGGATGATCTCGAGATCATCCGCGAATCTTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-1054s1c1
Sequence:CCGGCCAATCCTCTACAACCTCATTCTCGAGAATGAGGTTGTAGAGGATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-1038s1c1
Sequence:CCGGGAGCGCATCTATCAACCCAATCTCGAGATTGGGTTGATAGATGCGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-683s1c1
Sequence:CCGGCGGCGCTGTTCAGCCGCGAATCTCGAGATTCGCGGCTGAACAGCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001507.1-1030s21c1
Sequence:CCGGTTCTATCTGAGCGCATCTATCCTCGAGGATAGATGCGCTCAGATAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-1059s1c1
Sequence:CCGGCCTCTACAACCTCATTTCAAACTCGAGTTTGAAATGAGGTTGTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001507.1-939s1c1
Sequence:CCGGCTTCCACGTTGGCAGAATCATCTCGAGATGATTCTGCCAACGTGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)