EMAIL THIS PAGE TO A FRIEND

MLPH

melanophilin

73 Gene Product Result for
Synonyms: SLAC2-A
UniProtKB ID: Q9BV36, Q9HA71
Gene ID:
Human(79083) Summary: This gene encodes a member of the exophilin subfamily of Rab effector proteins. The protein forms a ternary complex with the small Ras-related GTPase Rab27A in its GTP-bound form and the motor protein myosin Va. A similar protein complex in mouse functions to tether pigment-producing organelles called melanosomes to the actin cytoskeleton in melanocytes, and is required for visible pigmentation in the hair and skin. A mutation in this gene results in Griscelli syndrome type 3, which is characterized by a silver-gray hair color and abnormal pigment distribution in the hair shaft. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(171531) melanophilin
Rat(316620) melanophilin
chicken(424019) melanophilin
dog(607077) melanophilin
Horse(100066385) melanophilin
cow(531343) melanophilin
domestic cat(780791) melanophilin
sheep(100272215) melanophilin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074671 MISSION® esiRNA esiRNA human MLPH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042467 Rosetta Predictions human pricing
NM_024101 Rosetta Predictions human pricing
NM_001012135 Rosetta Predictions rat pricing
XM_576609 Rosetta Predictions rat pricing
NM_053015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309948 predicted 2195
2 SASI_Hs02_00309949 predicted 274
3 SASI_Hs02_00309950 predicted 1663
4 SASI_Hs02_00309951 predicted 1937
5 SASI_Hs02_00309952 predicted 1665
6 SASI_Hs02_00309953 predicted 1446
7 SASI_Hs02_00309954 predicted 274
8 SASI_Hs02_00309955 predicted 276
9 SASI_Hs02_00309956 predicted 2203
10 SASI_Hs02_00309957 predicted 2212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356582 predicted 2281
2 SASI_Hs01_00137342 predicted 272
3 SASI_Hs01_00137343 predicted 1742
4 SASI_Hs01_00137346 predicted 2020
5 SASI_Hs01_00137347 predicted 1750
6 SASI_Hs01_00137348 predicted 1527
7 SASI_Hs01_00137349 predicted 274
8 SASI_Hs02_00356583 predicted 283
9 SASI_Hs02_00356584 predicted 2285
10 SASI_Hs02_00356585 predicted 2300
11 SASI_Hs01_00137341 predicted 1189
12 SASI_Hs01_00137344 predicted 1199
13 SASI_Hs01_00137345 predicted 1054
14 SASI_Hs01_00137350 predicted 1815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094149 predicted 1158
2 SASI_Rn01_00094150 predicted 982
3 SASI_Rn01_00094151 predicted 1659
4 SASI_Rn01_00094154 predicted 1546
5 SASI_Rn01_00094155 predicted 1949
6 SASI_Rn02_00200305 predicted 1550
7 SASI_Rn01_00094156 predicted 1052
8 SASI_Rn01_00094157 predicted 1848
9 SASI_Rn02_00200306 predicted 317
10 SASI_Rn01_00094158 predicted 1670
11 SASI_Rn01_00094152 predicted 1048
12 SASI_Rn01_00094153 predicted 1613
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195842 predicted 1166
2 SASI_Rn01_00195843 predicted 1564
3 SASI_Rn01_00195844 predicted 1159
4 SASI_Rn01_00195845 predicted 1015
5 SASI_Rn01_00195846 predicted 366
6 SASI_Rn01_00195847 predicted 1044
7 SASI_Rn01_00195848 predicted 1613
8 SASI_Rn01_00195849 predicted 1544
9 SASI_Rn01_00195850 predicted 477
10 SASI_Rn01_00195851 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137324 predicted 951
2 SASI_Mm01_00137325 predicted 1628
3 SASI_Mm02_00337515 predicted 2012
4 SASI_Mm01_00137328 predicted 1504
5 SASI_Mm01_00137329 predicted 1549
6 SASI_Mm01_00137330 predicted 1502
7 SASI_Mm01_00137332 predicted 1541
8 SASI_Mm01_00137333 predicted 1684
9 SASI_Mm02_00337516 predicted 922
10 SASI_Mm02_00337517 predicted 1976
11 SASI_Mm01_00137326 predicted 1066
12 SASI_Mm01_00137327 predicted 1661
13 SASI_Mm01_00137331 predicted 1078
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024101
VALIDATED
MLPH MISSION shRNA Bacterial Glycerol Stock
melanophilin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024101.4-2205s1c1
Sequence:CCGGCTGATCTGTGAGAAACAGCTACTCGAGTAGCTGTTTCTCACAGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024101.4-1871s1c1
Sequence:CCGGGATCGGAAATCAGTGTACCGACTCGAGTCGGTACACTGATTTCCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024101.4-1532s1c1
Sequence:CCGGCAGTACAACAGGACCACAGATCTCGAGATCTGTGGTCCTGTTGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024101.4-2241s1c1
Sequence:CCGGCCTTTAGGACAATGTTGTGTACTCGAGTACACAACATTGTCCTAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_024101.4-1180s1c1
Sequence:CCGGGTCTTCTGAGAGTCAGATCTTCTCGAGAAGATCTGACTCTCAGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024101.5-1232s21c1
Sequence:CCGGGTCTTCTGAGAGTCAGATCTTCTCGAGAAGATCTGACTCTCAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024101.5-2257s21c1
Sequence:CCGGCTGATCTGTGAGAAACAGCTACTCGAGTAGCTGTTTCTCACAGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024101.5-2293s21c1
Sequence:CCGGCCTTTAGGACAATGTTGTGTACTCGAGTACACAACATTGTCCTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024101.5-1923s21c1
Sequence:CCGGGATCGGAAATCAGTGTACCGACTCGAGTCGGTACACTGATTTCCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024101
VALIDATED
MLPH MISSION shRNA shRNA Plasmid DNA
melanophilin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024101.4-2205s1c1
Sequence:CCGGCTGATCTGTGAGAAACAGCTACTCGAGTAGCTGTTTCTCACAGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024101.4-1871s1c1
Sequence:CCGGGATCGGAAATCAGTGTACCGACTCGAGTCGGTACACTGATTTCCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024101.4-1532s1c1
Sequence:CCGGCAGTACAACAGGACCACAGATCTCGAGATCTGTGGTCCTGTTGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024101.4-2241s1c1
Sequence:CCGGCCTTTAGGACAATGTTGTGTACTCGAGTACACAACATTGTCCTAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_024101.4-1180s1c1
Sequence:CCGGGTCTTCTGAGAGTCAGATCTTCTCGAGAAGATCTGACTCTCAGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024101.5-1232s21c1
Sequence:CCGGGTCTTCTGAGAGTCAGATCTTCTCGAGAAGATCTGACTCTCAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024101.5-2257s21c1
Sequence:CCGGCTGATCTGTGAGAAACAGCTACTCGAGTAGCTGTTTCTCACAGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024101.5-2293s21c1
Sequence:CCGGCCTTTAGGACAATGTTGTGTACTCGAGTACACAACATTGTCCTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024101.5-1923s21c1
Sequence:CCGGGATCGGAAATCAGTGTACCGACTCGAGTCGGTACACTGATTTCCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024101
VALIDATED
MLPH MISSION shRNA Lentiviral Transduction Particles
melanophilin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024101.4-2205s1c1
Sequence:CCGGCTGATCTGTGAGAAACAGCTACTCGAGTAGCTGTTTCTCACAGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024101.4-1871s1c1
Sequence:CCGGGATCGGAAATCAGTGTACCGACTCGAGTCGGTACACTGATTTCCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024101.4-1532s1c1
Sequence:CCGGCAGTACAACAGGACCACAGATCTCGAGATCTGTGGTCCTGTTGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024101.4-2241s1c1
Sequence:CCGGCCTTTAGGACAATGTTGTGTACTCGAGTACACAACATTGTCCTAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_024101.4-1180s1c1
Sequence:CCGGGTCTTCTGAGAGTCAGATCTTCTCGAGAAGATCTGACTCTCAGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024101.5-1232s21c1
Sequence:CCGGGTCTTCTGAGAGTCAGATCTTCTCGAGAAGATCTGACTCTCAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024101.5-2257s21c1
Sequence:CCGGCTGATCTGTGAGAAACAGCTACTCGAGTAGCTGTTTCTCACAGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024101.5-2293s21c1
Sequence:CCGGCCTTTAGGACAATGTTGTGTACTCGAGTACACAACATTGTCCTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024101.5-1923s21c1
Sequence:CCGGGATCGGAAATCAGTGTACCGACTCGAGTCGGTACACTGATTTCCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053015
VALIDATED
MLPH MISSION shRNA Bacterial Glycerol Stock
melanophilin
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-1192s21c1
Sequence:CCGGTTGGAGTTGAACAAGCGAATGCTCGAGCATTCGCTTGTTCAACTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-946s21c1
Sequence:CCGGGTGCAGCCATGTAGCCCTTTACTCGAGTAAAGGGCTACATGGCTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053015.1-2251s1c1
Sequence:CCGGGCTGTGATTCTTTAACCCGATCTCGAGATCGGGTTAAAGAATCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-2258s21c1
Sequence:CCGGTTAACCCGATCCTCGACTTTGCTCGAGCAAAGTCGAGGATCGGGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053015.2-1661s21c1
Sequence:CCGGAGTCAGGCATCCCGATCTTTCCTCGAGGAAAGATCGGGATGCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-1229s21c1
Sequence:CCGGTGCTAGTCCACCTGGAGAATACTCGAGTATTCTCCAGGTGGACTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053015
VALIDATED
MLPH MISSION shRNA shRNA Plasmid DNA
melanophilin
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-1192s21c1
Sequence:CCGGTTGGAGTTGAACAAGCGAATGCTCGAGCATTCGCTTGTTCAACTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-946s21c1
Sequence:CCGGGTGCAGCCATGTAGCCCTTTACTCGAGTAAAGGGCTACATGGCTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053015.1-2251s1c1
Sequence:CCGGGCTGTGATTCTTTAACCCGATCTCGAGATCGGGTTAAAGAATCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-2258s21c1
Sequence:CCGGTTAACCCGATCCTCGACTTTGCTCGAGCAAAGTCGAGGATCGGGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053015.2-1661s21c1
Sequence:CCGGAGTCAGGCATCCCGATCTTTCCTCGAGGAAAGATCGGGATGCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-1229s21c1
Sequence:CCGGTGCTAGTCCACCTGGAGAATACTCGAGTATTCTCCAGGTGGACTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053015
VALIDATED
MLPH MISSION shRNA Lentiviral Transduction Particles
melanophilin
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-1192s21c1
Sequence:CCGGTTGGAGTTGAACAAGCGAATGCTCGAGCATTCGCTTGTTCAACTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-946s21c1
Sequence:CCGGGTGCAGCCATGTAGCCCTTTACTCGAGTAAAGGGCTACATGGCTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053015.1-2251s1c1
Sequence:CCGGGCTGTGATTCTTTAACCCGATCTCGAGATCGGGTTAAAGAATCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-2258s21c1
Sequence:CCGGTTAACCCGATCCTCGACTTTGCTCGAGCAAAGTCGAGGATCGGGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053015.2-1661s21c1
Sequence:CCGGAGTCAGGCATCCCGATCTTTCCTCGAGGAAAGATCGGGATGCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_053015.2-1229s21c1
Sequence:CCGGTGCTAGTCCACCTGGAGAATACTCGAGTATTCTCCAGGTGGACTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)