EMAIL THIS PAGE TO A FRIEND

MLST8

MTOR associated protein, LST8 homolog (S. cerevisiae)

108 Gene Product Result for
Synonyms: GBL GbetaL LST8 POP3 WAT1
Gene ID:
Mouse(56716) MTOR associated protein, LST8 homolog (S. cerevisiae)
Rat(64226) MTOR associated protein, LST8 homolog (S. cerevisiae)
Zebrafish(792689) MTOR associated protein, LST8 homolog (S. cerevisiae)
dog(610936) MTOR associated protein, LST8 homolog (S. cerevisiae)
domestic cat(101081776) MTOR associated protein, LST8 homolog (S. cerevisiae)
chicken(416558) MTOR associated protein, LST8 homolog (S. cerevisiae)
cow(535236) MTOR associated protein, LST8 homolog (S. cerevisiae)
Goat(100861036) MTOR associated protein, LST8 homolog (S. cerevisiae)
sheep(101114666) MTOR associated protein, LST8 homolog (S. cerevisiae)
domestic guinea pig(100732619) MTOR associated protein, LST8 homolog (S. cerevisiae)
naked mole-rat(101710106) MTOR associated protein, LST8 homolog (S. cerevisiae)
Domestic Rabbit(100359276) MTOR associated protein, LST8 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21973 Anti-GBL antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
SAB1407869 Anti-GBL antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
PRS3495 Anti-GBL antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900382 Anti-GBL antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB1411253 Anti-GBL antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
HPA041841 Anti-MLST8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4200306 Anti-mLST8/GBL (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunoprecipitation (IP), western blot pricing
SAB4200305 Anti-mLST8/GBL antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
western blot pricing
PLA0131 Rabbit anti-GbetaL Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, horse, human, primate, rhesus monkey, guinea pig, rat, mouse, rabbit, bovine, goat, pig
immunoprecipitation (IP), proximity ligation assay pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022372 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022372 Rosetta Predictions human pricing
NM_022404 Rosetta Predictions rat pricing
NM_019988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193066 predicted 352
2 SASI_Hs01_00193067 predicted 669
3 SASI_Hs02_00355675 predicted 663
4 SASI_Hs01_00193068 predicted 1033
5 SASI_Hs01_00193069 predicted 488
6 SASI_Hs01_00193070 predicted 536
7 SASI_Hs01_00193071 predicted 293
8 SASI_Hs01_00193073 predicted 376
9 SASI_Hs01_00193074 predicted 1267
10 SASI_Hs02_00355676 predicted 1080
11 SASI_Hs01_00193065 predicted 249
12 SASI_Hs01_00193072 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097067 predicted 917
2 SASI_Rn01_00097068 predicted 1270
3 SASI_Rn01_00097069 predicted 538
4 SASI_Rn02_00263179 predicted 1201
5 SASI_Rn01_00097070 predicted 899
6 SASI_Rn01_00097071 predicted 395
7 SASI_Rn01_00097072 predicted 1125
8 SASI_Rn02_00263180 predicted 1393
9 SASI_Rn02_00263181 predicted 778
10 SASI_Rn02_00263182 predicted 1257
11 SASI_Rn01_00097066 predicted 747
12 SASI_Rn01_00097073 predicted 595
13 SASI_Rn01_00097074 predicted 940
14 SASI_Rn01_00097075 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105942 predicted 861
2 SASI_Mm01_00105943 predicted 279
3 SASI_Mm01_00105944 predicted 1010
4 SASI_Mm01_00105945 predicted 523
5 SASI_Mm01_00105946 predicted 444
6 SASI_Mm01_00105947 predicted 1101
7 SASI_Mm01_00105948 predicted 349
8 SASI_Mm01_00105949 predicted 1174
9 SASI_Mm01_00105950 predicted 334
10 SASI_Mm01_00105951 predicted 1095
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019988
VALIDATED
MLST8 MISSION shRNA Bacterial Glycerol Stock
MTOR associated protein, LST8 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019988.3-381s21c1
Sequence:CCGGAGGATGGTCGCTGGATGTATACTCGAGTATACATCCAGCGACCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019988.3-473s21c1
Sequence:CCGGCAGGTGAACGCACCCATTAATCTCGAGATTAATGGGTGCGTTCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019988.3-869s21c1
Sequence:CCGGCTTAGCATCAAGAGTAGTAACCTCGAGGTTACTACTCTTGATGCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019988.3-299s21c1
Sequence:CCGGTATGATCTCAACTCCAATAACCTCGAGGTTATTGGAGTTGAGATCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019988.3-271s21c1
Sequence:CCGGTGCTGCAGGTTACCAACATATCTCGAGATATGTTGGTAACCTGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019988.2-299s1c1
Sequence:CCGGGTATGATCTCAACTCCAATAACTCGAGTTATTGGAGTTGAGATCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019988.2-519s1c1
Sequence:CCGGGCAGAACTCATTGTGGGTGATCTCGAGATCACCCACAATGAGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019988.2-943s1c1
Sequence:CCGGCCCAGTACATTGTCACAGCTTCTCGAGAAGCTGTGACAATGTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019988.2-215s1c1
Sequence:CCGGGCATCAGGACTCTCAGGTAAACTCGAGTTTACCTGAGAGTCCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019988.2-869s1c1
Sequence:CCGGGCTTAGCATCAAGAGTAGTAACTCGAGTTACTACTCTTGATGCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019988
VALIDATED
MLST8 MISSION shRNA shRNA Plasmid DNA
MTOR associated protein, LST8 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019988.3-381s21c1
Sequence:CCGGAGGATGGTCGCTGGATGTATACTCGAGTATACATCCAGCGACCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019988.3-473s21c1
Sequence:CCGGCAGGTGAACGCACCCATTAATCTCGAGATTAATGGGTGCGTTCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019988.3-869s21c1
Sequence:CCGGCTTAGCATCAAGAGTAGTAACCTCGAGGTTACTACTCTTGATGCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019988.3-299s21c1
Sequence:CCGGTATGATCTCAACTCCAATAACCTCGAGGTTATTGGAGTTGAGATCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019988.3-271s21c1
Sequence:CCGGTGCTGCAGGTTACCAACATATCTCGAGATATGTTGGTAACCTGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019988.2-299s1c1
Sequence:CCGGGTATGATCTCAACTCCAATAACTCGAGTTATTGGAGTTGAGATCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019988.2-519s1c1
Sequence:CCGGGCAGAACTCATTGTGGGTGATCTCGAGATCACCCACAATGAGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019988.2-943s1c1
Sequence:CCGGCCCAGTACATTGTCACAGCTTCTCGAGAAGCTGTGACAATGTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019988.2-215s1c1
Sequence:CCGGGCATCAGGACTCTCAGGTAAACTCGAGTTTACCTGAGAGTCCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019988.2-869s1c1
Sequence:CCGGGCTTAGCATCAAGAGTAGTAACTCGAGTTACTACTCTTGATGCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019988
VALIDATED
MLST8 MISSION shRNA Lentiviral Transduction Particles
MTOR associated protein, LST8 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019988.3-381s21c1
Sequence:CCGGAGGATGGTCGCTGGATGTATACTCGAGTATACATCCAGCGACCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019988.3-473s21c1
Sequence:CCGGCAGGTGAACGCACCCATTAATCTCGAGATTAATGGGTGCGTTCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019988.3-869s21c1
Sequence:CCGGCTTAGCATCAAGAGTAGTAACCTCGAGGTTACTACTCTTGATGCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019988.3-299s21c1
Sequence:CCGGTATGATCTCAACTCCAATAACCTCGAGGTTATTGGAGTTGAGATCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019988.3-271s21c1
Sequence:CCGGTGCTGCAGGTTACCAACATATCTCGAGATATGTTGGTAACCTGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019988.2-299s1c1
Sequence:CCGGGTATGATCTCAACTCCAATAACTCGAGTTATTGGAGTTGAGATCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019988.2-519s1c1
Sequence:CCGGGCAGAACTCATTGTGGGTGATCTCGAGATCACCCACAATGAGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019988.2-943s1c1
Sequence:CCGGCCCAGTACATTGTCACAGCTTCTCGAGAAGCTGTGACAATGTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019988.2-215s1c1
Sequence:CCGGGCATCAGGACTCTCAGGTAAACTCGAGTTTACCTGAGAGTCCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019988.2-869s1c1
Sequence:CCGGGCTTAGCATCAAGAGTAGTAACTCGAGTTACTACTCTTGATGCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022372
MLST8 MISSION shRNA Bacterial Glycerol Stock
MTOR associated protein, LST8 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022372.2-1575s1c1
Sequence:CCGGGCCAGGTGGAAGGGTTTATTACTCGAGTAATAAACCCTTCCACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-436s1c1
Sequence:CCGGCCAGCGGATCTTCCAGGTGAACTCGAGTTCACCTGGAAGATCCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-646s1c1
Sequence:CCGGCGGAAACTGCTATGTCTGGAACTCGAGTTCCAGACATAGCAGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-265s1c1
Sequence:CCGGCATCCGCATGTATGATCTCAACTCGAGTTGAGATCATACATGCGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-844s1c1
Sequence:CCGGGCTGAGCATCAAGAGCGGCAACTCGAGTTGCCGCTCTTGATGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022372
MLST8 MISSION shRNA shRNA Plasmid DNA
MTOR associated protein, LST8 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022372.2-1575s1c1
Sequence:CCGGGCCAGGTGGAAGGGTTTATTACTCGAGTAATAAACCCTTCCACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-436s1c1
Sequence:CCGGCCAGCGGATCTTCCAGGTGAACTCGAGTTCACCTGGAAGATCCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-646s1c1
Sequence:CCGGCGGAAACTGCTATGTCTGGAACTCGAGTTCCAGACATAGCAGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-265s1c1
Sequence:CCGGCATCCGCATGTATGATCTCAACTCGAGTTGAGATCATACATGCGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-844s1c1
Sequence:CCGGGCTGAGCATCAAGAGCGGCAACTCGAGTTGCCGCTCTTGATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022372
MLST8 MISSION shRNA Lentiviral Transduction Particles
MTOR associated protein, LST8 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022372.2-1575s1c1
Sequence:CCGGGCCAGGTGGAAGGGTTTATTACTCGAGTAATAAACCCTTCCACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-436s1c1
Sequence:CCGGCCAGCGGATCTTCCAGGTGAACTCGAGTTCACCTGGAAGATCCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-646s1c1
Sequence:CCGGCGGAAACTGCTATGTCTGGAACTCGAGTTCCAGACATAGCAGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-265s1c1
Sequence:CCGGCATCCGCATGTATGATCTCAACTCGAGTTGAGATCATACATGCGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022372.2-844s1c1
Sequence:CCGGGCTGAGCATCAAGAGCGGCAACTCGAGTTGCCGCTCTTGATGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)