EMAIL THIS PAGE TO A FRIEND

MLX

MLX, MAX dimerization protein

101 Gene Product Result for
Synonyms: MAD7 MXD7 TCFL4 bHLHd13
Gene ID:
Human(6945) Summary: The product of this gene belongs to the family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors. These factors form heterodimers with Mad proteins and play a role in proliferation, determination and differentiation. This gene product may act to diversify Mad family function by its restricted association with a subset of the Mad family of transcriptional repressors, namely, Mad1 and Mad4. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(21428) MAX-like protein X
Rat(360631) MLX, MAX dimerization protein
Goat(100861042) MAX-like protein X
sheep(101102914) MLX, MAX dimerization protein
domestic guinea pig(100718663) MLX, MAX dimerization protein
naked mole-rat(101716781) MLX, MAX dimerization protein
Zebrafish(554119) MAX-like protein X
dog(607668) MAX-like protein X
domestic cat(101097852) MAX-like protein X
cow(508531) MAX-like protein X
cow(786043) transcription factor-like protein 4
chicken(420026) MAX-like protein X
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101487 Anti-MLX (ab1) antibody produced in rabbit affinity isolated antibody pig, bovine, dog, mouse, human, goat, horse, rabbit, rat
western blot pricing
AV33424 Anti-MLX (AB1) antibody produced in rabbit affinity isolated antibody horse, bovine, mouse, pig, dog, human, goat, rat
immunohistochemistry, western blot pricing
SAB2101488 Anti-MLX (ab2) antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, mouse, human, zebrafish, rabbit, bovine, rat, chicken, horse
western blot pricing
AV39967 Anti-MLX (AB2) antibody produced in rabbit affinity isolated antibody bovine, mouse, pig, rat, horse, dog, goat, human, rabbit
immunohistochemistry, western blot pricing
AV51651 Anti-MLX (AB3) antibody produced in rabbit affinity isolated antibody rat, pig, dog, bovine, horse, human, mouse, goat
immunohistochemistry, western blot pricing
SAB2501956 Anti-MLX antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, mouse, human, canine, rat
ELISA, immunohistochemistry pricing
SAB1406515 Anti-MLX antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108176 Anti-MLX antibody produced in rabbit affinity isolated antibody human, horse, bovine, mouse, dog, pig, goat, rat, rabbit
immunohistochemistry, western blot pricing
AV39966 Anti-MLX antibody produced in rabbit IgG fraction of antiserum bovine, rabbit, mouse, human, pig, goat, rat
western blot pricing
HPA052766 Anti-MLX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4502934 Anti-MLX antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
HPA064438 Anti-MLX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1402937 Monoclonal Anti-MLX antibody produced in mouse clone 1C3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170607 Rosetta Predictions human pricing
NM_198204 Rosetta Predictions human pricing
NM_198205 Rosetta Predictions human pricing
NM_001034112 Rosetta Predictions rat pricing
NM_011550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163686 predicted 663
2 SASI_Hs01_00163687 predicted 1292
3 SASI_Hs01_00163688 predicted 674
4 SASI_Hs01_00163689 predicted 769
5 SASI_Hs01_00163691 predicted 905
6 SASI_Hs01_00163692 predicted 647
7 SASI_Hs01_00163694 predicted 1333
8 SASI_Hs01_00163695 predicted 1368
9 SASI_Hs02_00367560 predicted 1295
10 SASI_Hs02_00367561 predicted 1371
11 SASI_Hs01_00163690 predicted 1259
12 SASI_Hs01_00163693 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206104 predicted 502
2 SASI_Hs01_00206105 predicted 1134
3 SASI_Hs01_00206106 predicted 509
4 SASI_Hs01_00206107 predicted 605
5 SASI_Hs01_00206109 predicted 747
6 SASI_Hs01_00206110 predicted 484
7 SASI_Hs01_00206112 predicted 1172
8 SASI_Hs01_00206113 predicted 1203
9 SASI_Hs02_00371738 predicted 1135
10 SASI_Hs02_00371739 predicted 1209
11 SASI_Hs01_00206108 predicted 1098
12 SASI_Hs01_00206111 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049359 predicted 412
2 SASI_Hs01_00049360 predicted 1041
3 SASI_Hs01_00049361 predicted 416
4 SASI_Hs01_00049362 predicted 513
5 SASI_Hs01_00049364 predicted 659
6 SASI_Hs01_00049365 predicted 397
7 SASI_Hs01_00049367 predicted 1083
8 SASI_Hs01_00049368 predicted 1119
9 SASI_Hs02_00371740 predicted 1045
10 SASI_Hs02_00371741 predicted 1115
11 SASI_Hs01_00049363 predicted 1015
12 SASI_Hs01_00049366 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034112 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098129 predicted 1105
2 SASI_Rn01_00098130 predicted 537
3 SASI_Rn01_00098131 predicted 926
4 SASI_Rn01_00098132 predicted 360
5 SASI_Rn01_00098133 predicted 275
6 SASI_Rn02_00203952 predicted 831
7 SASI_Rn01_00098134 predicted 431
8 SASI_Rn01_00098135 predicted 998
9 SASI_Rn01_00098136 predicted 1190
10 SASI_Rn01_00098137 predicted 1188
11 SASI_Rn01_00098128 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025272 predicted 548
2 SASI_Mm01_00025273 predicted 938
3 SASI_Mm01_00025274 predicted 858
4 SASI_Mm01_00025275 predicted 549
5 SASI_Mm01_00025276 predicted 280
6 SASI_Mm01_00025277 predicted 985
7 SASI_Mm01_00025279 predicted 370
8 SASI_Mm01_00025280 predicted 494
9 SASI_Mm02_00320901 predicted 670
10 SASI_Mm01_00025281 predicted 773
11 SASI_Mm01_00025278 predicted 966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170607
VALIDATED
MLX MISSION shRNA Bacterial Glycerol Stock
MLX, MAX dimerization protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_170607.2-670s1c1
Sequence:CCGGGCAAGGATGTCACCGCCCTAACTCGAGTTAGGGCGGTGACATCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170607.2-1071s1c1
Sequence:CCGGGCTGGTTTCTACTTGGTGTTTCTCGAGAAACACCAAGTAGAAACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_170607.2-426s1c1
Sequence:CCGGGCCTACAAGGAGTCCTACAAACTCGAGTTTGTAGGACTCCTTGTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170607.2-553s1c1
Sequence:CCGGACTTCTCCATTGGCTCCCAAACTCGAGTTTGGGAGCCAATGGAGAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_170607.2-771s1c1
Sequence:CCGGCAGGTCAAGTTCAACGTGTTTCTCGAGAAACACGTTGAACTTGACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-671s21c1
Sequence:CCGGCAAGGATGTCACCGCCCTAAACTCGAGTTTAGGGCGGTGACATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-772s21c1
Sequence:CCGGAGGTCAAGTTCAACGTGTTTCCTCGAGGAAACACGTTGAACTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-1071s21c1
Sequence:CCGGGCTGGTTTCTACTTGGTGTTTCTCGAGAAACACCAAGTAGAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-337s21c1
Sequence:CCGGGTGTAGTGTCCAGAGCTAATACTCGAGTATTAGCTCTGGACACTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-426s21c1
Sequence:CCGGGCCTACAAGGAGTCCTACAAACTCGAGTTTGTAGGACTCCTTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170607
VALIDATED
MLX MISSION shRNA shRNA Plasmid DNA
MLX, MAX dimerization protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_170607.2-670s1c1
Sequence:CCGGGCAAGGATGTCACCGCCCTAACTCGAGTTAGGGCGGTGACATCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170607.2-1071s1c1
Sequence:CCGGGCTGGTTTCTACTTGGTGTTTCTCGAGAAACACCAAGTAGAAACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_170607.2-426s1c1
Sequence:CCGGGCCTACAAGGAGTCCTACAAACTCGAGTTTGTAGGACTCCTTGTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170607.2-553s1c1
Sequence:CCGGACTTCTCCATTGGCTCCCAAACTCGAGTTTGGGAGCCAATGGAGAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_170607.2-771s1c1
Sequence:CCGGCAGGTCAAGTTCAACGTGTTTCTCGAGAAACACGTTGAACTTGACCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-671s21c1
Sequence:CCGGCAAGGATGTCACCGCCCTAAACTCGAGTTTAGGGCGGTGACATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-772s21c1
Sequence:CCGGAGGTCAAGTTCAACGTGTTTCCTCGAGGAAACACGTTGAACTTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-1071s21c1
Sequence:CCGGGCTGGTTTCTACTTGGTGTTTCTCGAGAAACACCAAGTAGAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-337s21c1
Sequence:CCGGGTGTAGTGTCCAGAGCTAATACTCGAGTATTAGCTCTGGACACTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-426s21c1
Sequence:CCGGGCCTACAAGGAGTCCTACAAACTCGAGTTTGTAGGACTCCTTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170607
VALIDATED
MLX MISSION shRNA Lentiviral Transduction Particles
MLX, MAX dimerization protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_170607.2-670s1c1
Sequence:CCGGGCAAGGATGTCACCGCCCTAACTCGAGTTAGGGCGGTGACATCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170607.2-1071s1c1
Sequence:CCGGGCTGGTTTCTACTTGGTGTTTCTCGAGAAACACCAAGTAGAAACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_170607.2-426s1c1
Sequence:CCGGGCCTACAAGGAGTCCTACAAACTCGAGTTTGTAGGACTCCTTGTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170607.2-553s1c1
Sequence:CCGGACTTCTCCATTGGCTCCCAAACTCGAGTTTGGGAGCCAATGGAGAAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_170607.2-771s1c1
Sequence:CCGGCAGGTCAAGTTCAACGTGTTTCTCGAGAAACACGTTGAACTTGACCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-671s21c1
Sequence:CCGGCAAGGATGTCACCGCCCTAAACTCGAGTTTAGGGCGGTGACATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-772s21c1
Sequence:CCGGAGGTCAAGTTCAACGTGTTTCCTCGAGGAAACACGTTGAACTTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-1071s21c1
Sequence:CCGGGCTGGTTTCTACTTGGTGTTTCTCGAGAAACACCAAGTAGAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-337s21c1
Sequence:CCGGGTGTAGTGTCCAGAGCTAATACTCGAGTATTAGCTCTGGACACTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_170607.2-426s21c1
Sequence:CCGGGCCTACAAGGAGTCCTACAAACTCGAGTTTGTAGGACTCCTTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011550
VALIDATED
MLX MISSION shRNA Bacterial Glycerol Stock
MLX, MAX dimerization protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-766s1c1
Sequence:CCGGCCAGTCTTTCAACGCCTCTATCTCGAGATAGAGGCGTTGAAAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-721s1c1
Sequence:CCGGCCAGGTCAAGTTCAACGTCTTCTCGAGAAGACGTTGAACTTGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011550.2-877s1c1
Sequence:CCGGCGGTGTCCTTCATCAGTTGAACTCGAGTTCAACTGATGAAGGACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-649s1c1
Sequence:CCGGGAAAGTGAACTATGAGCAAATCTCGAGATTTGCTCATAGTTCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-446s1c1
Sequence:CCGGGCTATTAAGAGAGGCTATGATCTCGAGATCATAGCCTCTCTTAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-1313s21c1
Sequence:CCGGGCAACACTTGGCTCAAGTTTGCTCGAGCAAACTTGAGCCAAGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-897s21c1
Sequence:CCGGCGGTGTCCTTCATCAGTTGAACTCGAGTTCAACTGATGAAGGACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-466s21c1
Sequence:CCGGGCTATTAAGAGAGGCTATGATCTCGAGATCATAGCCTCTCTTAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-669s21c1
Sequence:CCGGGAAAGTGAACTATGAGCAAATCTCGAGATTTGCTCATAGTTCACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-368s21c1
Sequence:CCGGATGATGAGGACAGTGATTATCCTCGAGGATAATCACTGTCCTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011550
VALIDATED
MLX MISSION shRNA shRNA Plasmid DNA
MLX, MAX dimerization protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-766s1c1
Sequence:CCGGCCAGTCTTTCAACGCCTCTATCTCGAGATAGAGGCGTTGAAAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-721s1c1
Sequence:CCGGCCAGGTCAAGTTCAACGTCTTCTCGAGAAGACGTTGAACTTGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011550.2-877s1c1
Sequence:CCGGCGGTGTCCTTCATCAGTTGAACTCGAGTTCAACTGATGAAGGACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-649s1c1
Sequence:CCGGGAAAGTGAACTATGAGCAAATCTCGAGATTTGCTCATAGTTCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-446s1c1
Sequence:CCGGGCTATTAAGAGAGGCTATGATCTCGAGATCATAGCCTCTCTTAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-1313s21c1
Sequence:CCGGGCAACACTTGGCTCAAGTTTGCTCGAGCAAACTTGAGCCAAGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-897s21c1
Sequence:CCGGCGGTGTCCTTCATCAGTTGAACTCGAGTTCAACTGATGAAGGACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-466s21c1
Sequence:CCGGGCTATTAAGAGAGGCTATGATCTCGAGATCATAGCCTCTCTTAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-669s21c1
Sequence:CCGGGAAAGTGAACTATGAGCAAATCTCGAGATTTGCTCATAGTTCACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-368s21c1
Sequence:CCGGATGATGAGGACAGTGATTATCCTCGAGGATAATCACTGTCCTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011550
VALIDATED
MLX MISSION shRNA Lentiviral Transduction Particles
MLX, MAX dimerization protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-766s1c1
Sequence:CCGGCCAGTCTTTCAACGCCTCTATCTCGAGATAGAGGCGTTGAAAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-721s1c1
Sequence:CCGGCCAGGTCAAGTTCAACGTCTTCTCGAGAAGACGTTGAACTTGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011550.2-877s1c1
Sequence:CCGGCGGTGTCCTTCATCAGTTGAACTCGAGTTCAACTGATGAAGGACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-649s1c1
Sequence:CCGGGAAAGTGAACTATGAGCAAATCTCGAGATTTGCTCATAGTTCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011550.2-446s1c1
Sequence:CCGGGCTATTAAGAGAGGCTATGATCTCGAGATCATAGCCTCTCTTAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294617    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-1313s21c1
Sequence:CCGGGCAACACTTGGCTCAAGTTTGCTCGAGCAAACTTGAGCCAAGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-897s21c1
Sequence:CCGGCGGTGTCCTTCATCAGTTGAACTCGAGTTCAACTGATGAAGGACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-466s21c1
Sequence:CCGGGCTATTAAGAGAGGCTATGATCTCGAGATCATAGCCTCTCTTAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-669s21c1
Sequence:CCGGGAAAGTGAACTATGAGCAAATCTCGAGATTTGCTCATAGTTCACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011550.3-368s21c1
Sequence:CCGGATGATGAGGACAGTGATTATCCTCGAGGATAATCACTGTCCTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)