EMAIL THIS PAGE TO A FRIEND

MLXIP

MLX interacting protein

76 Gene Product Result for
Synonyms: MIR MONDOA bHLHe36
Gene ID:
Human(22877) Summary: MONDOA forms heterodimers with MLX (MIM 602976) that can bind to and activate transcription from CACGTG E boxes (Billin et al., 2000 [PubMed 11073985]
Mouse(208104) MLX interacting protein
Rat(304479) MLX interacting protein
Zebrafish(798052) MLX interacting protein
cow(783217) MLX interacting protein
Horse(100060001) MLX interacting protein
domestic cat(101095442) MLX interacting protein
dog(477464) MLX interacting protein
chicken(416857) MLX interacting protein
naked mole-rat(101706955) MLX interacting protein
Domestic Rabbit(100344781) MLX interacting protein
domestic guinea pig(100724992) MLX interacting protein
sheep(101102760) MLX interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014938 Rosetta Predictions human pricing
XM_001079320 Rosetta Predictions rat pricing
XM_222162 Rosetta Predictions rat pricing
NM_133917 Rosetta Predictions mouse pricing
NM_177582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037849 predicted 410
2 SASI_Hs01_00037850 predicted 895
3 SASI_Hs02_00346609 predicted 944
4 SASI_Hs01_00037852 predicted 812
5 SASI_Hs01_00037853 predicted 2447
6 SASI_Hs01_00037854 predicted 462
7 SASI_Hs01_00037855 predicted 2486
8 SASI_Hs01_00037856 predicted 1410
9 SASI_Hs01_00037857 predicted 1214
10 SASI_Hs01_00037858 predicted 636
11 SASI_Hs01_00037851 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363979 predicted 2120
2 SASI_Rn02_00363980 predicted 687
3 SASI_Rn02_00363981 predicted 699
4 SASI_Rn02_00363982 predicted 1313
5 SASI_Rn02_00363983 predicted 1395
6 SASI_Rn02_00363984 predicted 2423
7 SASI_Rn02_00363985 predicted 879
8 SASI_Rn02_00363986 predicted 1273
9 SASI_Rn02_00363987 predicted 816
10 SASI_Rn02_00363988 predicted 2173
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380585 predicted 1939
2 SASI_Rn02_00380586 predicted 1988
3 SASI_Rn02_00380587 predicted 2204
4 SASI_Rn02_00380588 predicted 1533
5 SASI_Rn02_00380589 predicted 1215
6 SASI_Rn02_00380590 predicted 2190
7 SASI_Rn02_00380591 predicted 1881
8 SASI_Rn02_00380592 predicted 1995
9 SASI_Rn02_00380593 predicted 1574
10 SASI_Rn02_00380594 predicted 2285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338991 predicted 681
2 SASI_Mm02_00338992 predicted 610
3 SASI_Mm02_00338993 predicted 746
4 SASI_Mm02_00338994 predicted 526
5 SASI_Mm01_00142432 predicted 392
6 SASI_Mm01_00142433 predicted 853
7 SASI_Mm01_00142435 predicted 1245
8 SASI_Mm01_00142437 predicted 1300
9 SASI_Mm02_00338995 predicted 1017
10 SASI_Mm02_00338996 predicted 1138
11 SASI_Mm01_00142428 predicted 1043
12 SASI_Mm01_00142429 predicted 1220
13 SASI_Mm01_00142430 predicted 864
14 SASI_Mm01_00142431 predicted 827
15 SASI_Mm01_00142434 predicted 941
16 SASI_Mm01_00142436 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347753 predicted 683
2 SASI_Mm01_00061657 predicted 608
3 SASI_Mm01_00061658 predicted 744
4 SASI_Mm02_00347754 predicted 521
5 SASI_Mm02_00347755 predicted 392
6 SASI_Mm01_00061659 predicted 860
7 SASI_Mm01_00061660 predicted 1244
8 SASI_Mm02_00347756 predicted 1302
9 SASI_Mm02_00347757 predicted 1013
10 SASI_Mm02_00347758 predicted 1144
11 SASI_Mm01_00061655 predicted 1926
12 SASI_Mm01_00061656 predicted 1353
13 SASI_Mm01_00061661 predicted 1991
14 SASI_Mm01_00061662 predicted 1548
15 SASI_Mm01_00061663 predicted 1937
16 SASI_Mm01_00061664 predicted 2009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014938
VALIDATED
MLXIP MISSION shRNA Bacterial Glycerol Stock
MLX interacting protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-1418s21c1
Sequence:CCGGAGTTTGCTGGAGTCAACAAAGCTCGAGCTTTGTTGACTCCAGCAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-2455s21c1
Sequence:CCGGATGTTTGACGAATACGTGAAACTCGAGTTTCACGTATTCGTCAAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-276s21c1
Sequence:CCGGGCCCAAGAAGGGCTACGATTTCTCGAGAAATCGTAGCCCTTCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-904s21c1
Sequence:CCGGGAAATAGCACATCTGGGAAATCTCGAGATTTCCCAGATGTGCTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-1746s21c1
Sequence:CCGGCCAACCACAAGCGGTGATCATCTCGAGATGATCACCGCTTGTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-519s21c1
Sequence:CCGGGTATCTGGAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTCCAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014938.3-3230s21c1
Sequence:CCGGGCAGTTGGAAGGCGTCTTTCTCTCGAGAGAAAGACGCCTTCCAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-2431s1c1
Sequence:CCGGCGCCAGTTTGATCACATGAAACTCGAGTTTCATGTGATCAAACTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014938.2-384s1c1
Sequence:CCGGGCTCTTCGAGTGCATGACTTTCTCGAGAAAGTCATGCACTCGAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-2145s1c1
Sequence:CCGGTGCACTAAAGAACCGGCAGATCTCGAGATCTGCCGGTTCTTTAGTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-646s1c1
Sequence:CCGGGAGATTGTGATCCGGGAGTATCTCGAGATACTCCCGGATCACAATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-1696s1c1
Sequence:CCGGGTGTCCTTGGTGTTGAAGAATCTCGAGATTCTTCAACACCAAGGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014938
VALIDATED
MLXIP MISSION shRNA shRNA Plasmid DNA
MLX interacting protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-1418s21c1
Sequence:CCGGAGTTTGCTGGAGTCAACAAAGCTCGAGCTTTGTTGACTCCAGCAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-2455s21c1
Sequence:CCGGATGTTTGACGAATACGTGAAACTCGAGTTTCACGTATTCGTCAAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-276s21c1
Sequence:CCGGGCCCAAGAAGGGCTACGATTTCTCGAGAAATCGTAGCCCTTCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-904s21c1
Sequence:CCGGGAAATAGCACATCTGGGAAATCTCGAGATTTCCCAGATGTGCTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-1746s21c1
Sequence:CCGGCCAACCACAAGCGGTGATCATCTCGAGATGATCACCGCTTGTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-519s21c1
Sequence:CCGGGTATCTGGAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTCCAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014938.3-3230s21c1
Sequence:CCGGGCAGTTGGAAGGCGTCTTTCTCTCGAGAGAAAGACGCCTTCCAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-2431s1c1
Sequence:CCGGCGCCAGTTTGATCACATGAAACTCGAGTTTCATGTGATCAAACTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014938.2-384s1c1
Sequence:CCGGGCTCTTCGAGTGCATGACTTTCTCGAGAAAGTCATGCACTCGAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-2145s1c1
Sequence:CCGGTGCACTAAAGAACCGGCAGATCTCGAGATCTGCCGGTTCTTTAGTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-646s1c1
Sequence:CCGGGAGATTGTGATCCGGGAGTATCTCGAGATACTCCCGGATCACAATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-1696s1c1
Sequence:CCGGGTGTCCTTGGTGTTGAAGAATCTCGAGATTCTTCAACACCAAGGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014938
VALIDATED
MLXIP MISSION shRNA Lentiviral Transduction Particles
MLX interacting protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-1418s21c1
Sequence:CCGGAGTTTGCTGGAGTCAACAAAGCTCGAGCTTTGTTGACTCCAGCAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-2455s21c1
Sequence:CCGGATGTTTGACGAATACGTGAAACTCGAGTTTCACGTATTCGTCAAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-276s21c1
Sequence:CCGGGCCCAAGAAGGGCTACGATTTCTCGAGAAATCGTAGCCCTTCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-904s21c1
Sequence:CCGGGAAATAGCACATCTGGGAAATCTCGAGATTTCCCAGATGTGCTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-1746s21c1
Sequence:CCGGCCAACCACAAGCGGTGATCATCTCGAGATGATCACCGCTTGTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014938.3-519s21c1
Sequence:CCGGGTATCTGGAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTCCAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014938.3-3230s21c1
Sequence:CCGGGCAGTTGGAAGGCGTCTTTCTCTCGAGAGAAAGACGCCTTCCAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-2431s1c1
Sequence:CCGGCGCCAGTTTGATCACATGAAACTCGAGTTTCATGTGATCAAACTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014938.2-384s1c1
Sequence:CCGGGCTCTTCGAGTGCATGACTTTCTCGAGAAAGTCATGCACTCGAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-2145s1c1
Sequence:CCGGTGCACTAAAGAACCGGCAGATCTCGAGATCTGCCGGTTCTTTAGTGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-646s1c1
Sequence:CCGGGAGATTGTGATCCGGGAGTATCTCGAGATACTCCCGGATCACAATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014938.2-1696s1c1
Sequence:CCGGGTGTCCTTGGTGTTGAAGAATCTCGAGATTCTTCAACACCAAGGACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177582
MLXIP MISSION shRNA Bacterial Glycerol Stock
MLX interacting protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-1000s21c1
Sequence:CCGGTGGCCCAACCCACGAGAAATACTCGAGTATTTCTCGTGGGTTGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-856s21c1
Sequence:CCGGGACATGCTGTATTGGCATAAACTCGAGTTTATGCCAATACAGCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-606s21c1
Sequence:CCGGCATCTGGAGGGCATGGTATATCTCGAGATATACCATGCCCTCCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177582.2-1960s21c1
Sequence:CCGGCAACAAAGCAATATGGATAATCTCGAGATTATCCATATTGCTTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-1398s21c1
Sequence:CCGGCCCTGTCTTTACGATGACCTTCTCGAGAAGGTCATCGTAAAGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177582.1-2391s1c1
Sequence:CCGGCCCAGTTAAAGAAACAGTTAACTCGAGTTAACTGTTTCTTTAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1932s1c1
Sequence:CCGGCCTTTCTCTAAGGCTTTACATCTCGAGATGTAAAGCCTTAGAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1471s1c1
Sequence:CCGGCCAACTGCATTGCCCTTAGTTCTCGAGAACTAAGGGCAATGCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1420s1c1
Sequence:CCGGCCTGTCTTTACGATGACCTTACTCGAGTAAGGTCATCGTAAAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1419s1c1
Sequence:CCGGCCCTGTCTTTACGATGACCTTCTCGAGAAGGTCATCGTAAAGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177582
MLXIP MISSION shRNA shRNA Plasmid DNA
MLX interacting protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-1000s21c1
Sequence:CCGGTGGCCCAACCCACGAGAAATACTCGAGTATTTCTCGTGGGTTGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-856s21c1
Sequence:CCGGGACATGCTGTATTGGCATAAACTCGAGTTTATGCCAATACAGCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-606s21c1
Sequence:CCGGCATCTGGAGGGCATGGTATATCTCGAGATATACCATGCCCTCCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177582.2-1960s21c1
Sequence:CCGGCAACAAAGCAATATGGATAATCTCGAGATTATCCATATTGCTTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-1398s21c1
Sequence:CCGGCCCTGTCTTTACGATGACCTTCTCGAGAAGGTCATCGTAAAGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177582.1-2391s1c1
Sequence:CCGGCCCAGTTAAAGAAACAGTTAACTCGAGTTAACTGTTTCTTTAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1932s1c1
Sequence:CCGGCCTTTCTCTAAGGCTTTACATCTCGAGATGTAAAGCCTTAGAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1471s1c1
Sequence:CCGGCCAACTGCATTGCCCTTAGTTCTCGAGAACTAAGGGCAATGCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1420s1c1
Sequence:CCGGCCTGTCTTTACGATGACCTTACTCGAGTAAGGTCATCGTAAAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1419s1c1
Sequence:CCGGCCCTGTCTTTACGATGACCTTCTCGAGAAGGTCATCGTAAAGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177582
MLXIP MISSION shRNA Lentiviral Transduction Particles
MLX interacting protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-1000s21c1
Sequence:CCGGTGGCCCAACCCACGAGAAATACTCGAGTATTTCTCGTGGGTTGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-856s21c1
Sequence:CCGGGACATGCTGTATTGGCATAAACTCGAGTTTATGCCAATACAGCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-606s21c1
Sequence:CCGGCATCTGGAGGGCATGGTATATCTCGAGATATACCATGCCCTCCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177582.2-1960s21c1
Sequence:CCGGCAACAAAGCAATATGGATAATCTCGAGATTATCCATATTGCTTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177582.2-1398s21c1
Sequence:CCGGCCCTGTCTTTACGATGACCTTCTCGAGAAGGTCATCGTAAAGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177582.1-2391s1c1
Sequence:CCGGCCCAGTTAAAGAAACAGTTAACTCGAGTTAACTGTTTCTTTAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1932s1c1
Sequence:CCGGCCTTTCTCTAAGGCTTTACATCTCGAGATGTAAAGCCTTAGAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1471s1c1
Sequence:CCGGCCAACTGCATTGCCCTTAGTTCTCGAGAACTAAGGGCAATGCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1420s1c1
Sequence:CCGGCCTGTCTTTACGATGACCTTACTCGAGTAAGGTCATCGTAAAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177582.1-1419s1c1
Sequence:CCGGCCCTGTCTTTACGATGACCTTCTCGAGAAGGTCATCGTAAAGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)