EMAIL THIS PAGE TO A FRIEND

MLYCD

malonyl-CoA decarboxylase

56 Gene Product Result for
Synonyms: MCD
UniProtKB ID: O95822, Q9UNU5, Q9Y3F2
Gene ID:
Human(23417) Summary: The product of this gene catalyzes the breakdown of malonyl-CoA to acetyl-CoA and carbon dioxide. Malonyl-CoA is an intermediate in fatty acid biosynthesis, and also inhibits the transport of fatty acyl CoAs into mitochondria. Consequently, the encoded protein acts to increase the rate of fatty acid oxidation. It is found in mitochondria, peroxisomes, and the cytoplasm. Mutations in this gene result in malonyl-CoA decarboyxlase deficiency. [provided by RefSeq, Jul 2008]
Mouse(56690) malonyl-CoA decarboxylase
Rat(85239) malonyl-CoA decarboxylase
Zebrafish(100037349) malonyl-CoA decarboxylase
dog(489688) malonyl-CoA decarboxylase
cow(512341) malonyl-CoA decarboxylase
domestic cat(101086616) malonyl-CoA decarboxylase
chicken(415812) malonyl-CoA decarboxylase
naked mole-rat(101716006) malonyl-CoA decarboxylase
Domestic Rabbit(100338228) malonyl-CoA decarboxylase
domestic guinea pig(100728189) malonyl-CoA decarboxylase
sheep(101122299) malonyl-CoA decarboxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
594687 α-Sexithiophene human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012213 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012213 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012213 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012213 Rosetta Predictions human pricing
NM_053477 Rosetta Predictions rat pricing
NM_019966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099982 predicted 1593
2 SASI_Hs01_00099983 predicted 826
3 SASI_Hs01_00099984 predicted 1801
4 SASI_Hs01_00099985 predicted 1501
5 SASI_Hs01_00099986 predicted 1072
6 SASI_Hs02_00343877 predicted 1590
7 SASI_Hs01_00099990 predicted 1934
8 SASI_Hs01_00099991 predicted 1310
9 SASI_Hs02_00343878 predicted 802
10 SASI_Hs02_00343879 predicted 1081
11 SASI_Hs01_00099987 predicted 964
12 SASI_Hs01_00099988 predicted 1616
13 SASI_Hs01_00099989 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110672 predicted 796
2 SASI_Rn01_00110673 predicted 367
3 SASI_Rn01_00110674 predicted 1198
4 SASI_Rn01_00110675 predicted 1063
5 SASI_Rn01_00110677 predicted 1284
6 SASI_Rn01_00110678 predicted 903
7 SASI_Rn01_00110679 predicted 1186
8 SASI_Rn01_00110680 predicted 1736
9 SASI_Rn01_00110681 predicted 1392
10 SASI_Rn02_00266071 predicted 396
11 SASI_Rn01_00110676 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028572 predicted 603
2 SASI_Mm01_00028573 predicted 253
3 SASI_Mm01_00028574 predicted 208
4 SASI_Mm01_00028575 predicted 750
5 SASI_Mm01_00028576 predicted 656
6 SASI_Mm01_00028577 predicted 1029
7 SASI_Mm01_00028578 predicted 1864
8 SASI_Mm02_00325267 predicted 1584
9 SASI_Mm01_00028579 predicted 1341
10 SASI_Mm01_00028580 predicted 1093
11 SASI_Mm01_00028581 predicted 457
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012213
VALIDATED
MLYCD MISSION shRNA Bacterial Glycerol Stock
malonyl-CoA decarboxylase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012213.2-1490s21c1
Sequence:CCGGCAGCAAGCTCTGACAGTAAACCTCGAGGTTTACTGTCAGAGCTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012213.2-665s21c1
Sequence:CCGGTGAGGCTGTGCATCCTGTAAACTCGAGTTTACAGGATGCACAGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012213.2-830s21c1
Sequence:CCGGGGAACATCCTCCATCAGAAACCTCGAGGTTTCTGATGGAGGATGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012213.2-1887s21c1
Sequence:CCGGGCCCAGATAAGAATAGGTGTTCTCGAGAACACCTATTCTTATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012213.2-602s21c1
Sequence:CCGGCCTGAACCTAGAACGGGTTACCTCGAGGTAACCCGTTCTAGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-1839s1c1
Sequence:CCGGGCCCAGATAAGAATAGGTGTTCTCGAGAACACCTATTCTTATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-998s1c1
Sequence:CCGGGCTTCTGAACTCGCAAACGAACTCGAGTTCGTTTGCGAGTTCAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012213.1-958s1c1
Sequence:CCGGGTCTGTCACCTATACCTGGTTCTCGAGAACCAGGTATAGGTGACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-896s1c1
Sequence:CCGGCCTCATAAAGCGAGTCGTCAACTCGAGTTGACGACTCGCTTTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-1045s1c1
Sequence:CCGGCAGATTCGGAATGTAAGGAAACTCGAGTTTCCTTACATTCCGAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012213
VALIDATED
MLYCD MISSION shRNA shRNA Plasmid DNA
malonyl-CoA decarboxylase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012213.2-1490s21c1
Sequence:CCGGCAGCAAGCTCTGACAGTAAACCTCGAGGTTTACTGTCAGAGCTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012213.2-665s21c1
Sequence:CCGGTGAGGCTGTGCATCCTGTAAACTCGAGTTTACAGGATGCACAGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012213.2-830s21c1
Sequence:CCGGGGAACATCCTCCATCAGAAACCTCGAGGTTTCTGATGGAGGATGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012213.2-1887s21c1
Sequence:CCGGGCCCAGATAAGAATAGGTGTTCTCGAGAACACCTATTCTTATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012213.2-602s21c1
Sequence:CCGGCCTGAACCTAGAACGGGTTACCTCGAGGTAACCCGTTCTAGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-1839s1c1
Sequence:CCGGGCCCAGATAAGAATAGGTGTTCTCGAGAACACCTATTCTTATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-998s1c1
Sequence:CCGGGCTTCTGAACTCGCAAACGAACTCGAGTTCGTTTGCGAGTTCAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012213.1-958s1c1
Sequence:CCGGGTCTGTCACCTATACCTGGTTCTCGAGAACCAGGTATAGGTGACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-896s1c1
Sequence:CCGGCCTCATAAAGCGAGTCGTCAACTCGAGTTGACGACTCGCTTTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-1045s1c1
Sequence:CCGGCAGATTCGGAATGTAAGGAAACTCGAGTTTCCTTACATTCCGAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012213
VALIDATED
MLYCD MISSION shRNA Lentiviral Transduction Particles
malonyl-CoA decarboxylase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012213.2-1490s21c1
Sequence:CCGGCAGCAAGCTCTGACAGTAAACCTCGAGGTTTACTGTCAGAGCTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012213.2-665s21c1
Sequence:CCGGTGAGGCTGTGCATCCTGTAAACTCGAGTTTACAGGATGCACAGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012213.2-830s21c1
Sequence:CCGGGGAACATCCTCCATCAGAAACCTCGAGGTTTCTGATGGAGGATGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012213.2-1887s21c1
Sequence:CCGGGCCCAGATAAGAATAGGTGTTCTCGAGAACACCTATTCTTATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012213.2-602s21c1
Sequence:CCGGCCTGAACCTAGAACGGGTTACCTCGAGGTAACCCGTTCTAGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-1839s1c1
Sequence:CCGGGCCCAGATAAGAATAGGTGTTCTCGAGAACACCTATTCTTATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-998s1c1
Sequence:CCGGGCTTCTGAACTCGCAAACGAACTCGAGTTCGTTTGCGAGTTCAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012213.1-958s1c1
Sequence:CCGGGTCTGTCACCTATACCTGGTTCTCGAGAACCAGGTATAGGTGACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-896s1c1
Sequence:CCGGCCTCATAAAGCGAGTCGTCAACTCGAGTTGACGACTCGCTTTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012213.1-1045s1c1
Sequence:CCGGCAGATTCGGAATGTAAGGAAACTCGAGTTTCCTTACATTCCGAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019966
VALIDATED
MLYCD MISSION shRNA Bacterial Glycerol Stock
malonyl-CoA decarboxylase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019966.2-1914s1c1
Sequence:CCGGCGCAGCTTAAAGCTCAGACTACTCGAGTAGTCTGAGCTTTAAGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019966.2-1130s1c1
Sequence:CCGGGCCAAGAAATCTCAGCGGTTACTCGAGTAACCGCTGAGATTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019966.2-1506s1c1
Sequence:CCGGCCAGTTCCAGAACAACAGCAACTCGAGTTGCTGTTGTTCTGGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019966.2-1309s1c1
Sequence:CCGGGCCAACTTCCATCTGCAGAATCTCGAGATTCTGCAGATGGAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019966.2-1401s1c1
Sequence:CCGGCATGGTCAACTACCGCTACTACTCGAGTAGTAGCGGTAGTTGACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019966
VALIDATED
MLYCD MISSION shRNA shRNA Plasmid DNA
malonyl-CoA decarboxylase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019966.2-1914s1c1
Sequence:CCGGCGCAGCTTAAAGCTCAGACTACTCGAGTAGTCTGAGCTTTAAGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019966.2-1130s1c1
Sequence:CCGGGCCAAGAAATCTCAGCGGTTACTCGAGTAACCGCTGAGATTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019966.2-1506s1c1
Sequence:CCGGCCAGTTCCAGAACAACAGCAACTCGAGTTGCTGTTGTTCTGGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019966.2-1309s1c1
Sequence:CCGGGCCAACTTCCATCTGCAGAATCTCGAGATTCTGCAGATGGAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019966.2-1401s1c1
Sequence:CCGGCATGGTCAACTACCGCTACTACTCGAGTAGTAGCGGTAGTTGACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019966
VALIDATED
MLYCD MISSION shRNA Lentiviral Transduction Particles
malonyl-CoA decarboxylase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019966.2-1914s1c1
Sequence:CCGGCGCAGCTTAAAGCTCAGACTACTCGAGTAGTCTGAGCTTTAAGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019966.2-1130s1c1
Sequence:CCGGGCCAAGAAATCTCAGCGGTTACTCGAGTAACCGCTGAGATTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019966.2-1506s1c1
Sequence:CCGGCCAGTTCCAGAACAACAGCAACTCGAGTTGCTGTTGTTCTGGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019966.2-1309s1c1
Sequence:CCGGGCCAACTTCCATCTGCAGAATCTCGAGATTCTGCAGATGGAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019966.2-1401s1c1
Sequence:CCGGCATGGTCAACTACCGCTACTACTCGAGTAGTAGCGGTAGTTGACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)