EMAIL THIS PAGE TO A FRIEND

MMAA

methylmalonic aciduria (cobalamin deficiency) cblA type

52 Gene Product Result for
Synonyms: cblA
UniProtKB ID: Q8IVH4, B3KX40, Q495G7
Gene ID:
Human(166785) Summary: The protein encoded by this gene is involved in the translocation of cobalamin into the mitochondrion, where it is used in the final steps of adenosylcobalamin synthesis. Adenosylcobalamin is a coenzyme required for the activity of methylmalonyl-CoA mutase. Defects in this gene are a cause of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
Mouse(109136) methylmalonic aciduria (cobalamin deficiency) type A
Rat(291939) methylmalonic aciduria (cobalamin deficiency) cblA type
sheep(101109913) methylmalonic aciduria (cobalamin deficiency) cblA type
domestic guinea pig(100733063) methylmalonic aciduria (cobalamin deficiency) cblA type
Domestic Rabbit(100009376) methylmalonic aciduria (cobalamin deficiency) cblA type
naked mole-rat(101696374) methylmalonic aciduria (cobalamin deficiency) cblA type
Zebrafish(564760) methylmalonic aciduria (cobalamin deficiency) cblA type
domestic cat(101085459) methylmalonic aciduria (cobalamin deficiency) cblA type
cow(511673) methylmalonic aciduria (cobalamin deficiency) cblA type
Horse(100070911) methylmalonic aciduria (cobalamin deficiency) cblA type
dog(482635) methylmalonic aciduria (cobalamin deficiency) cblA type
chicken(422464) methylmalonic aciduria (cobalamin deficiency) cblA type
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172250 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172250 Rosetta Predictions human pricing
NM_001106174 Rosetta Predictions rat pricing
NM_133823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079649 predicted 341
2 SASI_Hs01_00079651 predicted 677
3 SASI_Hs02_00367962 predicted 1399
4 SASI_Hs01_00079653 predicted 311
5 SASI_Hs01_00079654 predicted 335
6 SASI_Hs01_00079655 predicted 669
7 SASI_Hs02_00367963 predicted 680
8 SASI_Hs02_00367964 predicted 1424
9 SASI_Hs01_00079657 predicted 723
10 SASI_Hs02_00367965 predicted 212
11 SASI_Hs01_00079650 predicted 1069
12 SASI_Hs01_00079652 predicted 1178
13 SASI_Hs01_00079656 predicted 271
14 SASI_Hs01_00079658 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216358 predicted 661
2 SASI_Rn02_00216359 predicted 669
3 SASI_Rn02_00216360 predicted 930
4 SASI_Rn02_00216361 predicted 1667
5 SASI_Rn02_00216362 predicted 665
6 SASI_Rn02_00216363 predicted 1089
7 SASI_Rn02_00216364 predicted 1102
8 SASI_Rn02_00216365 predicted 1502
9 SASI_Rn02_00216366 predicted 1018
10 SASI_Rn02_00216367 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187692 predicted 312
2 SASI_Mm01_00187693 predicted 971
3 SASI_Mm01_00187694 predicted 571
4 SASI_Mm01_00187695 predicted 369
5 SASI_Mm01_00187696 predicted 891
6 SASI_Mm01_00187697 predicted 652
7 SASI_Mm01_00187698 predicted 299
8 SASI_Mm01_00187699 predicted 706
9 SASI_Mm01_00187700 predicted 657
10 SASI_Mm01_00187701 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133823
MMAA MISSION shRNA Bacterial Glycerol Stock
methylmalonic aciduria (cobalamin deficiency) cblA type
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133823.2-2226s1c1
Sequence:CCGGGCCTCCTCAATGCTGAGATAACTCGAGTTATCTCAGCATTGAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-375s1c1
Sequence:CCGGCCATAACTCTCGTGGAATCAACTCGAGTTGATTCCACGAGAGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-898s1c1
Sequence:CCGGCATCATTGAAATGGCAGATTTCTCGAGAAATCTGCCATTTCAATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-323s1c1
Sequence:CCGGGATAGACTTTATACGGGTTTACTCGAGTAAACCCGTATAAAGTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-1078s1c1
Sequence:CCGGGTGGGACACAATGAGAGAGTTCTCGAGAACTCTCTCATTGTGTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-687s21c1
Sequence:CCGGGAGATATGAATGCCTACATCACTCGAGTGATGTAGGCATTCATATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-643s21c1
Sequence:CCGGTGGGTCCCTCTTAGGTGATAACTCGAGTTATCACCTAAGAGGGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-400s21c1
Sequence:CCGGTCTCGTGGAATCAACCCATACCTCGAGGTATGGGTTGATTCCACGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133823.4-1554s21c1
Sequence:CCGGGCTAGCCTGCTAAGTAGTTTCCTCGAGGAAACTACTTAGCAGGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-118s21c1
Sequence:CCGGTCCTAATCGGCGTTTACTAACCTCGAGGTTAGTAAACGCCGATTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133823
MMAA MISSION shRNA shRNA Plasmid DNA
methylmalonic aciduria (cobalamin deficiency) cblA type
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133823.2-2226s1c1
Sequence:CCGGGCCTCCTCAATGCTGAGATAACTCGAGTTATCTCAGCATTGAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-375s1c1
Sequence:CCGGCCATAACTCTCGTGGAATCAACTCGAGTTGATTCCACGAGAGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-898s1c1
Sequence:CCGGCATCATTGAAATGGCAGATTTCTCGAGAAATCTGCCATTTCAATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-323s1c1
Sequence:CCGGGATAGACTTTATACGGGTTTACTCGAGTAAACCCGTATAAAGTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-1078s1c1
Sequence:CCGGGTGGGACACAATGAGAGAGTTCTCGAGAACTCTCTCATTGTGTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-687s21c1
Sequence:CCGGGAGATATGAATGCCTACATCACTCGAGTGATGTAGGCATTCATATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-643s21c1
Sequence:CCGGTGGGTCCCTCTTAGGTGATAACTCGAGTTATCACCTAAGAGGGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-400s21c1
Sequence:CCGGTCTCGTGGAATCAACCCATACCTCGAGGTATGGGTTGATTCCACGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133823.4-1554s21c1
Sequence:CCGGGCTAGCCTGCTAAGTAGTTTCCTCGAGGAAACTACTTAGCAGGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-118s21c1
Sequence:CCGGTCCTAATCGGCGTTTACTAACCTCGAGGTTAGTAAACGCCGATTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133823
MMAA MISSION shRNA Lentiviral Transduction Particles
methylmalonic aciduria (cobalamin deficiency) cblA type
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133823.2-2226s1c1
Sequence:CCGGGCCTCCTCAATGCTGAGATAACTCGAGTTATCTCAGCATTGAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-375s1c1
Sequence:CCGGCCATAACTCTCGTGGAATCAACTCGAGTTGATTCCACGAGAGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-898s1c1
Sequence:CCGGCATCATTGAAATGGCAGATTTCTCGAGAAATCTGCCATTTCAATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-323s1c1
Sequence:CCGGGATAGACTTTATACGGGTTTACTCGAGTAAACCCGTATAAAGTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133823.2-1078s1c1
Sequence:CCGGGTGGGACACAATGAGAGAGTTCTCGAGAACTCTCTCATTGTGTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-687s21c1
Sequence:CCGGGAGATATGAATGCCTACATCACTCGAGTGATGTAGGCATTCATATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-643s21c1
Sequence:CCGGTGGGTCCCTCTTAGGTGATAACTCGAGTTATCACCTAAGAGGGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-400s21c1
Sequence:CCGGTCTCGTGGAATCAACCCATACCTCGAGGTATGGGTTGATTCCACGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133823.4-1554s21c1
Sequence:CCGGGCTAGCCTGCTAAGTAGTTTCCTCGAGGAAACTACTTAGCAGGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133823.4-118s21c1
Sequence:CCGGTCCTAATCGGCGTTTACTAACCTCGAGGTTAGTAAACGCCGATTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172250
MMAA MISSION shRNA Bacterial Glycerol Stock
methylmalonic aciduria (cobalamin deficiency) cblA type
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-649s1c1
Sequence:CCGGCCCGAATGACTGAGTTATCAACTCGAGTTGATAACTCAGTCATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-963s1c1
Sequence:CCGGCGAAGGATACAAGCGGAATATCTCGAGATATTCCGCTTGTATCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-766s1c1
Sequence:CCGGCGGGATATGACATAATTCTTACTCGAGTAAGAATTATGTCATATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-765s1c1
Sequence:CCGGGCGGGATATGACATAATTCTTCTCGAGAAGAATTATGTCATATCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172250.2-1769s21c1
Sequence:CCGGTAAGAGCCGACAATCATAATTCTCGAGAATTATGATTGTCGGCTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-990s1c1
Sequence:CCGGGCACTGAAATTACTCCGCAAACTCGAGTTTGCGGAGTAATTTCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172250.2-1706s21c1
Sequence:CCGGTAAACAAGAGTGACCATATTTCTCGAGAAATATGGTCACTCTTGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172250.2-280s21c1
Sequence:CCGGATGTGTACAAACAACCTTAAACTCGAGTTTAAGGTTGTTTGTACACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172250
MMAA MISSION shRNA shRNA Plasmid DNA
methylmalonic aciduria (cobalamin deficiency) cblA type
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-649s1c1
Sequence:CCGGCCCGAATGACTGAGTTATCAACTCGAGTTGATAACTCAGTCATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-963s1c1
Sequence:CCGGCGAAGGATACAAGCGGAATATCTCGAGATATTCCGCTTGTATCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-766s1c1
Sequence:CCGGCGGGATATGACATAATTCTTACTCGAGTAAGAATTATGTCATATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-765s1c1
Sequence:CCGGGCGGGATATGACATAATTCTTCTCGAGAAGAATTATGTCATATCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172250.2-1769s21c1
Sequence:CCGGTAAGAGCCGACAATCATAATTCTCGAGAATTATGATTGTCGGCTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-990s1c1
Sequence:CCGGGCACTGAAATTACTCCGCAAACTCGAGTTTGCGGAGTAATTTCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172250.2-1706s21c1
Sequence:CCGGTAAACAAGAGTGACCATATTTCTCGAGAAATATGGTCACTCTTGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172250.2-280s21c1
Sequence:CCGGATGTGTACAAACAACCTTAAACTCGAGTTTAAGGTTGTTTGTACACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172250
MMAA MISSION shRNA Lentiviral Transduction Particles
methylmalonic aciduria (cobalamin deficiency) cblA type
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-649s1c1
Sequence:CCGGCCCGAATGACTGAGTTATCAACTCGAGTTGATAACTCAGTCATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-963s1c1
Sequence:CCGGCGAAGGATACAAGCGGAATATCTCGAGATATTCCGCTTGTATCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-766s1c1
Sequence:CCGGCGGGATATGACATAATTCTTACTCGAGTAAGAATTATGTCATATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-765s1c1
Sequence:CCGGGCGGGATATGACATAATTCTTCTCGAGAAGAATTATGTCATATCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172250.2-1769s21c1
Sequence:CCGGTAAGAGCCGACAATCATAATTCTCGAGAATTATGATTGTCGGCTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172250.1-990s1c1
Sequence:CCGGGCACTGAAATTACTCCGCAAACTCGAGTTTGCGGAGTAATTTCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172250.2-1706s21c1
Sequence:CCGGTAAACAAGAGTGACCATATTTCTCGAGAAATATGGTCACTCTTGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172250.2-280s21c1
Sequence:CCGGATGTGTACAAACAACCTTAAACTCGAGTTTAAGGTTGTTTGTACACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)