EMAIL THIS PAGE TO A FRIEND

MMAB

methylmalonic aciduria (cobalamin deficiency) cblB type

99 Gene Product Result for
Synonyms: ATR cblB cob
UniProtKB ID: Q96EY8, C5HU05, Q9BSH0
Gene ID:
Human(326625) Summary: This gene encodes a protein that catalyzes the final step in the conversion of vitamin B(12) into adenosylcobalamin (AdoCbl), a vitamin B12-containing coenzyme for methylmalonyl-CoA mutase. Mutations in the gene are the cause of vitamin B12-dependent methylmalonic aciduria linked to the cblB complementation group. Alternatively spliced transcript variants have been found. [provided by RefSeq, Apr 2011]
Mouse(77697) methylmalonic aciduria (cobalamin deficiency) type B homolog (human)
Rat(687861) methylmalonic aciduria (cobalamin deficiency) cblB type
Zebrafish(557077) methylmalonic aciduria (cobalamin deficiency) cblB type
cow(617636) methylmalonic aciduria (cobalamin deficiency) cblB type
domestic cat(101093552) methylmalonic aciduria (cobalamin deficiency) cblB type
dog(486310) methylmalonic aciduria (cobalamin deficiency) cblB type
chicken(426287) methylmalonic aciduria (cobalamin deficiency) cblB type
naked mole-rat(101708163) methylmalonic aciduria (cobalamin deficiency) cblB type
domestic guinea pig(100714062) methylmalonic aciduria (cobalamin deficiency) cblB type
sheep(101114057) methylmalonic aciduria (cobalamin deficiency) cblB type
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052845 Rosetta Predictions human pricing
XM_001080395 Rosetta Predictions rat pricing
NM_029956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244224 predicted 329
2 SASI_Hs01_00244225 predicted 359
3 SASI_Hs01_00244226 predicted 807
4 SASI_Hs01_00244227 predicted 687
5 SASI_Hs01_00244228 predicted 356
6 SASI_Hs01_00244229 predicted 807
7 SASI_Hs01_00244230 predicted 335
8 SASI_Hs01_00244231 predicted 386
9 SASI_Hs01_00244233 predicted 328
10 SASI_Hs02_00361528 predicted 728
11 SASI_Hs01_00244232 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080395 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367855 predicted 262
2 SASI_Rn02_00367856 predicted 269
3 SASI_Rn02_00367857 predicted 243
4 SASI_Rn02_00367858 predicted 438
5 SASI_Rn02_00367859 predicted 209
6 SASI_Rn02_00367860 predicted 306
7 SASI_Rn02_00367861 predicted 479
8 SASI_Rn02_00367862 predicted 410
9 SASI_Rn02_00367863 predicted 437
10 SASI_Rn02_00367864 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336272 predicted 241
2 SASI_Mm01_00048694 predicted 781
3 SASI_Mm01_00048695 predicted 664
4 SASI_Mm01_00048696 predicted 632
5 SASI_Mm01_00048697 predicted 243
6 SASI_Mm01_00048699 predicted 289
7 SASI_Mm01_00048700 predicted 592
8 SASI_Mm01_00048701 predicted 329
9 SASI_Mm01_00048702 predicted 275
10 SASI_Mm02_00336273 predicted 695
11 SASI_Mm01_00048693 predicted 730
12 SASI_Mm01_00048698 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052845
VALIDATED
MMAB MISSION shRNA Bacterial Glycerol Stock
methylmalonic aciduria (cobalamin deficiency) cblB type
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-479s21c1
Sequence:CCGGCGGGAGGCTCACTTAAAGTATCTCGAGATACTTTAAGTGAGCCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-368s21c1
Sequence:CCGGGCTCTGGAATTAGTCACAGAACTCGAGTTCTGTGACTAATTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-302s21c1
Sequence:CCGGCCCAAAGATGACCAAGTGTTTCTCGAGAAACACTTGGTCATCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052845.2-246s1c1
Sequence:CCGGCCCAAAGATGACCAAGTGTTTCTCGAGAAACACTTGGTCATCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052845.2-423s1c1
Sequence:CCGGCGGGAGGCTCACTTAAAGTATCTCGAGATACTTTAAGTGAGCCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052845.2-271s1c1
Sequence:CCGGCCGTGGGAACTACAGATGAATCTCGAGATTCATCTGTAGTTCCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052845.2-1278s1c1
Sequence:CCGGGCGGACAAGATTTGGAAGTTTCTCGAGAAACTTCCAAATCTTGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052845.2-312s1c1
Sequence:CCGGGCTCTGGAATTAGTCACAGAACTCGAGTTCTGTGACTAATTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-327s21c1
Sequence:CCGGCCGTGGGAACTACAGATGAATCTCGAGATTCATCTGTAGTTCCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052845
VALIDATED
MMAB MISSION shRNA shRNA Plasmid DNA
methylmalonic aciduria (cobalamin deficiency) cblB type
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-479s21c1
Sequence:CCGGCGGGAGGCTCACTTAAAGTATCTCGAGATACTTTAAGTGAGCCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-368s21c1
Sequence:CCGGGCTCTGGAATTAGTCACAGAACTCGAGTTCTGTGACTAATTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-302s21c1
Sequence:CCGGCCCAAAGATGACCAAGTGTTTCTCGAGAAACACTTGGTCATCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052845.2-246s1c1
Sequence:CCGGCCCAAAGATGACCAAGTGTTTCTCGAGAAACACTTGGTCATCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052845.2-423s1c1
Sequence:CCGGCGGGAGGCTCACTTAAAGTATCTCGAGATACTTTAAGTGAGCCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052845.2-271s1c1
Sequence:CCGGCCGTGGGAACTACAGATGAATCTCGAGATTCATCTGTAGTTCCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052845.2-1278s1c1
Sequence:CCGGGCGGACAAGATTTGGAAGTTTCTCGAGAAACTTCCAAATCTTGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052845.2-312s1c1
Sequence:CCGGGCTCTGGAATTAGTCACAGAACTCGAGTTCTGTGACTAATTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-327s21c1
Sequence:CCGGCCGTGGGAACTACAGATGAATCTCGAGATTCATCTGTAGTTCCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052845
VALIDATED
MMAB MISSION shRNA Lentiviral Transduction Particles
methylmalonic aciduria (cobalamin deficiency) cblB type
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-479s21c1
Sequence:CCGGCGGGAGGCTCACTTAAAGTATCTCGAGATACTTTAAGTGAGCCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-368s21c1
Sequence:CCGGGCTCTGGAATTAGTCACAGAACTCGAGTTCTGTGACTAATTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-302s21c1
Sequence:CCGGCCCAAAGATGACCAAGTGTTTCTCGAGAAACACTTGGTCATCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052845.2-246s1c1
Sequence:CCGGCCCAAAGATGACCAAGTGTTTCTCGAGAAACACTTGGTCATCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052845.2-423s1c1
Sequence:CCGGCGGGAGGCTCACTTAAAGTATCTCGAGATACTTTAAGTGAGCCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_052845.2-271s1c1
Sequence:CCGGCCGTGGGAACTACAGATGAATCTCGAGATTCATCTGTAGTTCCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052845.2-1278s1c1
Sequence:CCGGGCGGACAAGATTTGGAAGTTTCTCGAGAAACTTCCAAATCTTGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052845.2-312s1c1
Sequence:CCGGGCTCTGGAATTAGTCACAGAACTCGAGTTCTGTGACTAATTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052845.3-327s21c1
Sequence:CCGGCCGTGGGAACTACAGATGAATCTCGAGATTCATCTGTAGTTCCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029956
MMAB MISSION shRNA Bacterial Glycerol Stock
methylmalonic aciduria (cobalamin deficiency) cblB type
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029956.3-676s21c1
Sequence:CCGGCTCTTCACTGTAGCCAGATATCTCGAGATATCTGGCTACAGTGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029956.3-245s21c1
Sequence:CCGGGACCTAAAGATGATCAAGTATCTCGAGATACTTGATCATCTTTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029956.3-2161s21c1
Sequence:CCGGCGCCTTTACATTGTACCCATTCTCGAGAATGGGTACAATGTAAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029956.3-647s21c1
Sequence:CCGGCGAAGTTCTTAAACAGGCTCACTCGAGTGAGCCTGTTTAAGAACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-676s1c1
Sequence:CCGGCTCTTCACTGTAGCCAGATATCTCGAGATATCTGGCTACAGTGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-647s1c1
Sequence:CCGGCGAAGTTCTTAAACAGGCTCACTCGAGTGAGCCTGTTTAAGAACTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029956.2-2161s1c1
Sequence:CCGGCGCCTTTACATTGTACCCATTCTCGAGAATGGGTACAATGTAAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-667s1c1
Sequence:CCGGAGTGATTACCTCTTCACTGTACTCGAGTACAGTGAAGAGGTAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-245s1c1
Sequence:CCGGGACCTAAAGATGATCAAGTATCTCGAGATACTTGATCATCTTTAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029956
MMAB MISSION shRNA shRNA Plasmid DNA
methylmalonic aciduria (cobalamin deficiency) cblB type
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029956.3-676s21c1
Sequence:CCGGCTCTTCACTGTAGCCAGATATCTCGAGATATCTGGCTACAGTGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029956.3-245s21c1
Sequence:CCGGGACCTAAAGATGATCAAGTATCTCGAGATACTTGATCATCTTTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029956.3-2161s21c1
Sequence:CCGGCGCCTTTACATTGTACCCATTCTCGAGAATGGGTACAATGTAAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029956.3-647s21c1
Sequence:CCGGCGAAGTTCTTAAACAGGCTCACTCGAGTGAGCCTGTTTAAGAACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-676s1c1
Sequence:CCGGCTCTTCACTGTAGCCAGATATCTCGAGATATCTGGCTACAGTGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-647s1c1
Sequence:CCGGCGAAGTTCTTAAACAGGCTCACTCGAGTGAGCCTGTTTAAGAACTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029956.2-2161s1c1
Sequence:CCGGCGCCTTTACATTGTACCCATTCTCGAGAATGGGTACAATGTAAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-667s1c1
Sequence:CCGGAGTGATTACCTCTTCACTGTACTCGAGTACAGTGAAGAGGTAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-245s1c1
Sequence:CCGGGACCTAAAGATGATCAAGTATCTCGAGATACTTGATCATCTTTAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029956
MMAB MISSION shRNA Lentiviral Transduction Particles
methylmalonic aciduria (cobalamin deficiency) cblB type
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029956.3-676s21c1
Sequence:CCGGCTCTTCACTGTAGCCAGATATCTCGAGATATCTGGCTACAGTGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029956.3-245s21c1
Sequence:CCGGGACCTAAAGATGATCAAGTATCTCGAGATACTTGATCATCTTTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029956.3-2161s21c1
Sequence:CCGGCGCCTTTACATTGTACCCATTCTCGAGAATGGGTACAATGTAAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029956.3-647s21c1
Sequence:CCGGCGAAGTTCTTAAACAGGCTCACTCGAGTGAGCCTGTTTAAGAACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-676s1c1
Sequence:CCGGCTCTTCACTGTAGCCAGATATCTCGAGATATCTGGCTACAGTGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-647s1c1
Sequence:CCGGCGAAGTTCTTAAACAGGCTCACTCGAGTGAGCCTGTTTAAGAACTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029956.2-2161s1c1
Sequence:CCGGCGCCTTTACATTGTACCCATTCTCGAGAATGGGTACAATGTAAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-667s1c1
Sequence:CCGGAGTGATTACCTCTTCACTGTACTCGAGTACAGTGAAGAGGTAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029956.2-245s1c1
Sequence:CCGGGACCTAAAGATGATCAAGTATCTCGAGATACTTGATCATCTTTAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)