EMAIL THIS PAGE TO A FRIEND

MMACHC

methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria

64 Gene Product Result for
Synonyms: RP11-291L19.3 cblC
UniProtKB ID: Q9Y4U1, Q5T157, Q9BRQ7
Gene ID:
Human(25974) Summary: The exact function of the protein encoded by this gene is not known, however, its C-terminal region shows similarity to TonB, a bacterial protein involved in energy transduction for cobalamin (vitamin B12) uptake. Hence, it is postulated that this protein may have a role in the binding and intracellular trafficking of cobalamin. Mutations in this gene are associated with methylmalonic aciduria and homocystinuria type cblC. [provided by RefSeq, Oct 2009]
Mouse(67096) methylmalonic aciduria cblC type, with homocystinuria
Rat(313520) methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
Zebrafish(555267) methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
chicken(424597) methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
domestic cat(101090955) methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
cow(513433) methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
dog(482514) methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
sheep(101120707) methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
domestic guinea pig(100735601) methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
naked mole-rat(101709397) methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015506 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015506 Rosetta Predictions human pricing
NM_001107962 Rosetta Predictions rat pricing
NM_025962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017554 predicted 691
2 SASI_Hs02_00347986 predicted 331
3 SASI_Hs01_00017556 predicted 834
4 SASI_Hs01_00017557 predicted 706
5 SASI_Hs01_00017558 predicted 578
6 SASI_Hs01_00017559 predicted 714
7 SASI_Hs01_00017560 predicted 394
8 SASI_Hs01_00017561 predicted 696
9 SASI_Hs01_00017562 predicted 680
10 SASI_Hs01_00017563 predicted 541
11 SASI_Hs01_00017555 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234005 predicted 1050
2 SASI_Rn02_00234006 predicted 500
3 SASI_Rn02_00234007 predicted 1046
4 SASI_Rn02_00234008 predicted 1073
5 SASI_Rn02_00234009 predicted 383
6 SASI_Rn02_00234010 predicted 1127
7 SASI_Rn02_00234011 predicted 395
8 SASI_Rn02_00234012 predicted 548
9 SASI_Rn02_00234013 predicted 336
10 SASI_Rn02_00234014 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329368 predicted 393
2 SASI_Mm02_00329369 predicted 290
3 SASI_Mm02_00329370 predicted 357
4 SASI_Mm02_00329371 predicted 639
5 SASI_Mm02_00329372 predicted 441
6 SASI_Mm02_00329373 predicted 561
7 SASI_Mm02_00329374 predicted 756
8 SASI_Mm02_00329375 predicted 675
9 SASI_Mm02_00329376 predicted 453
10 SASI_Mm02_00329377 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025962
MMACHC MISSION shRNA Bacterial Glycerol Stock
methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-579s1c1
Sequence:CCGGCTTGAAGGTTTCAATTTCCATCTCGAGATGGAAATTGAAACCTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-729s1c1
Sequence:CCGGCCTAGCACTACATCTGAGCTTCTCGAGAAGCTCAGATGTAGTGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-381s1c1
Sequence:CCGGGCTTATTACTACCAACGACAACTCGAGTTGTCGTTGGTAGTAATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-515s1c1
Sequence:CCGGGCCAAATTTGCCACCCAGAAACTCGAGTTTCTGGGTGGCAAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-808s1c1
Sequence:CCGGCAAGTGTCTCACCACCTGTATCTCGAGATACAGGTGGTGAGACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025962
MMACHC MISSION shRNA shRNA Plasmid DNA
methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-579s1c1
Sequence:CCGGCTTGAAGGTTTCAATTTCCATCTCGAGATGGAAATTGAAACCTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-729s1c1
Sequence:CCGGCCTAGCACTACATCTGAGCTTCTCGAGAAGCTCAGATGTAGTGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-381s1c1
Sequence:CCGGGCTTATTACTACCAACGACAACTCGAGTTGTCGTTGGTAGTAATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-515s1c1
Sequence:CCGGGCCAAATTTGCCACCCAGAAACTCGAGTTTCTGGGTGGCAAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-808s1c1
Sequence:CCGGCAAGTGTCTCACCACCTGTATCTCGAGATACAGGTGGTGAGACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025962
MMACHC MISSION shRNA Lentiviral Transduction Particles
methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-579s1c1
Sequence:CCGGCTTGAAGGTTTCAATTTCCATCTCGAGATGGAAATTGAAACCTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-729s1c1
Sequence:CCGGCCTAGCACTACATCTGAGCTTCTCGAGAAGCTCAGATGTAGTGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-381s1c1
Sequence:CCGGGCTTATTACTACCAACGACAACTCGAGTTGTCGTTGGTAGTAATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-515s1c1
Sequence:CCGGGCCAAATTTGCCACCCAGAAACTCGAGTTTCTGGGTGGCAAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025962.1-808s1c1
Sequence:CCGGCAAGTGTCTCACCACCTGTATCTCGAGATACAGGTGGTGAGACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015506
VALIDATED
MMACHC MISSION shRNA Bacterial Glycerol Stock
methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015506.2-864s21c1
Sequence:CCGGCCCTCAGAGAAGCCTAGTTCTCTCGAGAGAACTAGGCTTCTCTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_015506.1-886s1c1
Sequence:CCGGCCCTGATTTATGGTGGTACTTCTCGAGAAGTACCACCATAAATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-396s1c1
Sequence:CCGGGCTGCTTACTACTACCAACGACTCGAGTCGTTGGTAGTAGTAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015506.2-1042s21c1
Sequence:CCGGACTTAATTGGCTTTGGCAAAGCTCGAGCTTTGCCAAAGCCAATTAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-450s1c1
Sequence:CCGGCGCATATCAGGTGTGTGCATACTCGAGTATGCACACACCTGATATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-556s1c1
Sequence:CCGGCTCATGACTGTGTACCTACAACTCGAGTTGTAGGTACACAGTCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-399s1c1
Sequence:CCGGGCTTACTACTACCAACGACAACTCGAGTTGTCGTTGGTAGTAGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015506.1-1903s1c1
Sequence:CCGGGCCCTTTGAATAGTGTGTCTACTCGAGTAGACACACTATTCAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015506.1-105s1c1
Sequence:CCGGGCATGGTACAATGAACTCTTGCTCGAGCAAGAGTTCATTGTACCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-605s1c1
Sequence:CCGGCTTCAATTTCCACTGGCGTGACTCGAGTCACGCCAGTGGAAATTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015506.1-323s1c1
Sequence:CCGGCATTGCTGACTACGAGGTACACTCGAGTGTACCTCGTAGTCAGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015506
VALIDATED
MMACHC MISSION shRNA shRNA Plasmid DNA
methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015506.2-864s21c1
Sequence:CCGGCCCTCAGAGAAGCCTAGTTCTCTCGAGAGAACTAGGCTTCTCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_015506.1-886s1c1
Sequence:CCGGCCCTGATTTATGGTGGTACTTCTCGAGAAGTACCACCATAAATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-396s1c1
Sequence:CCGGGCTGCTTACTACTACCAACGACTCGAGTCGTTGGTAGTAGTAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015506.2-1042s21c1
Sequence:CCGGACTTAATTGGCTTTGGCAAAGCTCGAGCTTTGCCAAAGCCAATTAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-450s1c1
Sequence:CCGGCGCATATCAGGTGTGTGCATACTCGAGTATGCACACACCTGATATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-556s1c1
Sequence:CCGGCTCATGACTGTGTACCTACAACTCGAGTTGTAGGTACACAGTCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-399s1c1
Sequence:CCGGGCTTACTACTACCAACGACAACTCGAGTTGTCGTTGGTAGTAGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015506.1-1903s1c1
Sequence:CCGGGCCCTTTGAATAGTGTGTCTACTCGAGTAGACACACTATTCAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015506.1-105s1c1
Sequence:CCGGGCATGGTACAATGAACTCTTGCTCGAGCAAGAGTTCATTGTACCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-605s1c1
Sequence:CCGGCTTCAATTTCCACTGGCGTGACTCGAGTCACGCCAGTGGAAATTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015506.1-323s1c1
Sequence:CCGGCATTGCTGACTACGAGGTACACTCGAGTGTACCTCGTAGTCAGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015506
VALIDATED
MMACHC MISSION shRNA Lentiviral Transduction Particles
methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015506.2-864s21c1
Sequence:CCGGCCCTCAGAGAAGCCTAGTTCTCTCGAGAGAACTAGGCTTCTCTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153626    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_015506.1-886s1c1
Sequence:CCGGCCCTGATTTATGGTGGTACTTCTCGAGAAGTACCACCATAAATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-396s1c1
Sequence:CCGGGCTGCTTACTACTACCAACGACTCGAGTCGTTGGTAGTAGTAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015506.2-1042s21c1
Sequence:CCGGACTTAATTGGCTTTGGCAAAGCTCGAGCTTTGCCAAAGCCAATTAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-450s1c1
Sequence:CCGGCGCATATCAGGTGTGTGCATACTCGAGTATGCACACACCTGATATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-556s1c1
Sequence:CCGGCTCATGACTGTGTACCTACAACTCGAGTTGTAGGTACACAGTCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-399s1c1
Sequence:CCGGGCTTACTACTACCAACGACAACTCGAGTTGTCGTTGGTAGTAGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_015506.1-1903s1c1
Sequence:CCGGGCCCTTTGAATAGTGTGTCTACTCGAGTAGACACACTATTCAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015506.1-105s1c1
Sequence:CCGGGCATGGTACAATGAACTCTTGCTCGAGCAAGAGTTCATTGTACCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015506.1-605s1c1
Sequence:CCGGCTTCAATTTCCACTGGCGTGACTCGAGTCACGCCAGTGGAAATTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015506.1-323s1c1
Sequence:CCGGCATTGCTGACTACGAGGTACACTCGAGTGTACCTCGTAGTCAGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)