EMAIL THIS PAGE TO A FRIEND

MMADHC

methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria

71 Gene Product Result for
Synonyms: C2orf25 CL25022 cblD
UniProtKB ID: Q9H3L0, B2R895, D3DP91, O95891
Gene ID:
Human(27249) Summary: This gene encodes a mitochondrial protein that is involved in an early step of vitamin B12 metabolism. Vitamin B12 (cobalamin) is essential for normal development and survival in humans. Mutations in this gene cause methylmalonic aciduria and homocystinuria type cblD (MMADHC), a disorder of cobalamin metabolism that is characterized by decreased levels of the coenzymes adenosylcobalamin and methylcobalamin. Pseudogenes have been identified on chromosomes 11 and X.[provided by RefSeq, Nov 2008]
Mouse(109129) methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Rat(362134) methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
naked mole-rat(101715098) methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
domestic guinea pig(100730134) methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Zebrafish(402886) methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
cow(521533) methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
dog(476145) methylmalonic aciduria and homocystinuria type D homolog, mitochondrial-like
chicken(424311) methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015702 Rosetta Predictions human pricing
NM_001004280 Rosetta Predictions rat pricing
NM_133839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175684 predicted 462
2 SASI_Hs01_00175685 predicted 1062
3 SASI_Hs01_00175687 predicted 764
4 SASI_Hs01_00175688 predicted 293
5 SASI_Hs01_00175689 predicted 513
6 SASI_Hs01_00175690 predicted 698
7 SASI_Hs01_00175691 predicted 966
8 SASI_Hs01_00175692 predicted 896
9 SASI_Hs01_00175693 predicted 888
10 SASI_Hs02_00348372 predicted 572
11 SASI_Hs01_00175686 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071368 predicted 1054
2 SASI_Rn01_00071369 predicted 1079
3 SASI_Rn01_00071370 predicted 853
4 SASI_Rn01_00071371 predicted 884
5 SASI_Rn01_00071372 predicted 444
6 SASI_Rn01_00071373 predicted 439
7 SASI_Rn01_00071374 predicted 455
8 SASI_Rn01_00071375 predicted 965
9 SASI_Rn02_00198324 predicted 494
10 SASI_Rn01_00071376 predicted 647
11 SASI_Rn01_00071377 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198024 predicted 419
2 SASI_Mm01_00198025 predicted 223
3 SASI_Mm01_00198026 predicted 828
4 SASI_Mm01_00198027 predicted 1042
5 SASI_Mm01_00198028 predicted 1005
6 SASI_Mm01_00198031 predicted 707
7 SASI_Mm01_00198029 predicted 435
8 SASI_Mm01_00198030 predicted 698
9 SASI_Mm01_00198032 predicted 431
10 SASI_Mm01_00198033 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133839
VALIDATED
MMADHC MISSION shRNA Bacterial Glycerol Stock
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133839.2-457s21c1
Sequence:CCGGGATAGTGATGCACCTGTTGAACTCGAGTTCAACAGGTGCATCACTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216397    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133839.2-1061s1c1
Sequence:CCGGGATTCTTGTTTCTAGGTATTTCTCGAGAAATACCTAGAAACAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133839.2-1001s21c1
Sequence:CCGGGCTGTTTGTCTGTCATGGATTCTCGAGAATCCATGACAGACAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133839.2-606s21c1
Sequence:CCGGGATCCTGACTGTAACCCAGAACTCGAGTTCTGGGTTACAGTCAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133839.2-914s21c1
Sequence:CCGGGAAGTATCTTCACTAACGCAACTCGAGTTGCGTTAGTGAAGATACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-1160s1c1
Sequence:CCGGCGTGCTGAACACATCCATATTCTCGAGAATATGGATGTGTTCAGCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-606s1c1
Sequence:CCGGGATCCTGACTGTAACCCAGAACTCGAGTTCTGGGTTACAGTCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-914s1c1
Sequence:CCGGGAAGTATCTTCACTAACGCAACTCGAGTTGCGTTAGTGAAGATACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-1001s1c1
Sequence:CCGGGCTGTTTGTCTGTCATGGATTCTCGAGAATCCATGACAGACAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-457s1c1
Sequence:CCGGGATAGTGATGCACCTGTTGAACTCGAGTTCAACAGGTGCATCACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133839.1-790s1c1
Sequence:CCGGCCATATACCAACAACACACTTCTCGAGAAGTGTGTTGTTGGTATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133839
VALIDATED
MMADHC MISSION shRNA shRNA Plasmid DNA
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133839.2-457s21c1
Sequence:CCGGGATAGTGATGCACCTGTTGAACTCGAGTTCAACAGGTGCATCACTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216397    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133839.2-1061s1c1
Sequence:CCGGGATTCTTGTTTCTAGGTATTTCTCGAGAAATACCTAGAAACAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133839.2-1001s21c1
Sequence:CCGGGCTGTTTGTCTGTCATGGATTCTCGAGAATCCATGACAGACAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133839.2-606s21c1
Sequence:CCGGGATCCTGACTGTAACCCAGAACTCGAGTTCTGGGTTACAGTCAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133839.2-914s21c1
Sequence:CCGGGAAGTATCTTCACTAACGCAACTCGAGTTGCGTTAGTGAAGATACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-1160s1c1
Sequence:CCGGCGTGCTGAACACATCCATATTCTCGAGAATATGGATGTGTTCAGCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-606s1c1
Sequence:CCGGGATCCTGACTGTAACCCAGAACTCGAGTTCTGGGTTACAGTCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-914s1c1
Sequence:CCGGGAAGTATCTTCACTAACGCAACTCGAGTTGCGTTAGTGAAGATACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-1001s1c1
Sequence:CCGGGCTGTTTGTCTGTCATGGATTCTCGAGAATCCATGACAGACAAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-457s1c1
Sequence:CCGGGATAGTGATGCACCTGTTGAACTCGAGTTCAACAGGTGCATCACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133839.1-790s1c1
Sequence:CCGGCCATATACCAACAACACACTTCTCGAGAAGTGTGTTGTTGGTATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133839
VALIDATED
MMADHC MISSION shRNA Lentiviral Transduction Particles
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133839.2-457s21c1
Sequence:CCGGGATAGTGATGCACCTGTTGAACTCGAGTTCAACAGGTGCATCACTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216397    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133839.2-1061s1c1
Sequence:CCGGGATTCTTGTTTCTAGGTATTTCTCGAGAAATACCTAGAAACAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133839.2-1001s21c1
Sequence:CCGGGCTGTTTGTCTGTCATGGATTCTCGAGAATCCATGACAGACAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133839.2-606s21c1
Sequence:CCGGGATCCTGACTGTAACCCAGAACTCGAGTTCTGGGTTACAGTCAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133839.2-914s21c1
Sequence:CCGGGAAGTATCTTCACTAACGCAACTCGAGTTGCGTTAGTGAAGATACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-1160s1c1
Sequence:CCGGCGTGCTGAACACATCCATATTCTCGAGAATATGGATGTGTTCAGCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-606s1c1
Sequence:CCGGGATCCTGACTGTAACCCAGAACTCGAGTTCTGGGTTACAGTCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-914s1c1
Sequence:CCGGGAAGTATCTTCACTAACGCAACTCGAGTTGCGTTAGTGAAGATACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-1001s1c1
Sequence:CCGGGCTGTTTGTCTGTCATGGATTCTCGAGAATCCATGACAGACAAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_133839.1-457s1c1
Sequence:CCGGGATAGTGATGCACCTGTTGAACTCGAGTTCAACAGGTGCATCACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133839.1-790s1c1
Sequence:CCGGCCATATACCAACAACACACTTCTCGAGAAGTGTGTTGTTGGTATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015702
MMADHC MISSION shRNA Bacterial Glycerol Stock
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015702.2-1287s21c1
Sequence:CCGGCACGTTGAACACATCCACATTCTCGAGAATGTGGATGTGTTCAACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015702.2-515s21c1
Sequence:CCGGGCAGAACCTTTATCAAGTGAACTCGAGTTCACTTGATAAAGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015702.2-239s21c1
Sequence:CCGGGTTTCCTATCTCCCAGGATTTCTCGAGAAATCCTGGGAGATAGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015702.2-635s21c1
Sequence:CCGGGCCAGAGTAGAGTGTGCAATACTCGAGTATTGCACACTCTACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015702.1-1253s1c1
Sequence:CCGGCCACATTGTATAGGATGTGGTCTCGAGACCACATCCTATACAATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015702.1-1239s1c1
Sequence:CCGGCACGTTGAACACATCCACATTCTCGAGAATGTGGATGTGTTCAACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015702.1-653s1c1
Sequence:CCGGCCAGAAGTAGCTAATGGCAAACTCGAGTTTGCCATTAGCTACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015702.1-822s1c1
Sequence:CCGGCTGACTTTATTGACCCATCATCTCGAGATGATGGGTCAATAAAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015702.1-467s1c1
Sequence:CCGGGCAGAACCTTTATCAAGTGAACTCGAGTTCACTTGATAAAGGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015702.1-191s1c1
Sequence:CCGGGTTTCCTATCTCCCAGGATTTCTCGAGAAATCCTGGGAGATAGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015702.1-973s1c1
Sequence:CCGGCCATGTAGTTGTAGGGAGTATCTCGAGATACTCCCTACAACTACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015702.1-587s1c1
Sequence:CCGGGCCAGAGTAGAGTGTGCAATACTCGAGTATTGCACACTCTACTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015702
MMADHC MISSION shRNA shRNA Plasmid DNA
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015702.2-1287s21c1
Sequence:CCGGCACGTTGAACACATCCACATTCTCGAGAATGTGGATGTGTTCAACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015702.2-515s21c1
Sequence:CCGGGCAGAACCTTTATCAAGTGAACTCGAGTTCACTTGATAAAGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015702.2-239s21c1
Sequence:CCGGGTTTCCTATCTCCCAGGATTTCTCGAGAAATCCTGGGAGATAGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015702.2-635s21c1
Sequence:CCGGGCCAGAGTAGAGTGTGCAATACTCGAGTATTGCACACTCTACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015702.1-1253s1c1
Sequence:CCGGCCACATTGTATAGGATGTGGTCTCGAGACCACATCCTATACAATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015702.1-1239s1c1
Sequence:CCGGCACGTTGAACACATCCACATTCTCGAGAATGTGGATGTGTTCAACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015702.1-653s1c1
Sequence:CCGGCCAGAAGTAGCTAATGGCAAACTCGAGTTTGCCATTAGCTACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015702.1-822s1c1
Sequence:CCGGCTGACTTTATTGACCCATCATCTCGAGATGATGGGTCAATAAAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015702.1-467s1c1
Sequence:CCGGGCAGAACCTTTATCAAGTGAACTCGAGTTCACTTGATAAAGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015702.1-191s1c1
Sequence:CCGGGTTTCCTATCTCCCAGGATTTCTCGAGAAATCCTGGGAGATAGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015702.1-973s1c1
Sequence:CCGGCCATGTAGTTGTAGGGAGTATCTCGAGATACTCCCTACAACTACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015702.1-587s1c1
Sequence:CCGGGCCAGAGTAGAGTGTGCAATACTCGAGTATTGCACACTCTACTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015702
MMADHC MISSION shRNA Lentiviral Transduction Particles
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319161    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015702.2-1287s21c1
Sequence:CCGGCACGTTGAACACATCCACATTCTCGAGAATGTGGATGTGTTCAACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015702.2-515s21c1
Sequence:CCGGGCAGAACCTTTATCAAGTGAACTCGAGTTCACTTGATAAAGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015702.2-239s21c1
Sequence:CCGGGTTTCCTATCTCCCAGGATTTCTCGAGAAATCCTGGGAGATAGGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015702.2-635s21c1
Sequence:CCGGGCCAGAGTAGAGTGTGCAATACTCGAGTATTGCACACTCTACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015702.1-1253s1c1
Sequence:CCGGCCACATTGTATAGGATGTGGTCTCGAGACCACATCCTATACAATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153462    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015702.1-1239s1c1
Sequence:CCGGCACGTTGAACACATCCACATTCTCGAGAATGTGGATGTGTTCAACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015702.1-653s1c1
Sequence:CCGGCCAGAAGTAGCTAATGGCAAACTCGAGTTTGCCATTAGCTACTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015702.1-822s1c1
Sequence:CCGGCTGACTTTATTGACCCATCATCTCGAGATGATGGGTCAATAAAGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015702.1-467s1c1
Sequence:CCGGGCAGAACCTTTATCAAGTGAACTCGAGTTCACTTGATAAAGGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015702.1-191s1c1
Sequence:CCGGGTTTCCTATCTCCCAGGATTTCTCGAGAAATCCTGGGAGATAGGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015702.1-973s1c1
Sequence:CCGGCCATGTAGTTGTAGGGAGTATCTCGAGATACTCCCTACAACTACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015702.1-587s1c1
Sequence:CCGGGCCAGAGTAGAGTGTGCAATACTCGAGTATTGCACACTCTACTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)