EMAIL THIS PAGE TO A FRIEND

MMD2

monocyte to macrophage differentiation-associated 2

81 Gene Product Result for
Synonyms: PAQR10
UniProtKB ID: Q8IY49, B5MBW4, Q6NVU5, Q6TCH0
Gene ID:
Human(221938) Summary: This gene encodes a member of the PAQR (progestin and adipoQ receptor) family. Members of this family are evolutionarily conserved with significant sequence identity to bacterial hemolysin-like proteins and are defined by a set of seven transmembrane domains. The protein encoded by this gene localizes to the Golgi apparatus to modulate Ras signaling. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Human(100505381) Miyoshi muscular dystrophy 2
Mouse(75104) monocyte to macrophage differentiation-associated 2
Rat(304301) monocyte to macrophage differentiation-associated 2
chicken(416480) monocyte to macrophage differentiation-associated 2
cow(525334) monocyte to macrophage differentiation-associated 2
domestic cat(101095065) monocyte to macrophage differentiation-associated 2
dog(609327) monocyte to macrophage differentiation-associated 2
naked mole-rat(101720239) monocyte to macrophage differentiation-associated 2
sheep(101109506) monocyte to macrophage differentiation-associated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304071 ANTI-MMD2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
AV54545 Anti-MMD2 antibody produced in rabbit affinity isolated antibody rat, guinea pig, horse, zebrafish, human, rabbit, bovine, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198403 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031551 MISSION® esiRNA esiRNA human MMD2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100600 Rosetta Predictions human pricing
NM_198403 Rosetta Predictions human pricing
NM_001037217 Rosetta Predictions rat pricing
NM_175217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322224 predicted 947
2 SASI_Hs02_00322225 predicted 986
3 SASI_Hs02_00322226 predicted 1185
4 SASI_Hs02_00322227 predicted 1027
5 SASI_Hs02_00322228 predicted 1045
6 SASI_Hs02_00322229 predicted 1038
7 SASI_Hs02_00322230 predicted 384
8 SASI_Hs02_00322231 predicted 1210
9 SASI_Hs02_00322232 predicted 1174
10 SASI_Hs02_00322233 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371927 predicted 876
2 SASI_Hs02_00371928 predicted 909
3 SASI_Hs01_00198323 predicted 1109
4 SASI_Hs02_00371929 predicted 951
5 SASI_Hs02_00371930 predicted 977
6 SASI_Hs02_00371931 predicted 971
7 SASI_Hs02_00371932 predicted 392
8 SASI_Hs02_00371933 predicted 1145
9 SASI_Hs01_00198325 predicted 1104
10 SASI_Hs01_00198328 predicted 1019
11 SASI_Hs01_00198319 predicted 220
12 SASI_Hs01_00198320 predicted 1140
13 SASI_Hs01_00198321 predicted 986
14 SASI_Hs01_00198322 predicted 477
15 SASI_Hs01_00198324 predicted 932
16 SASI_Hs01_00198326 predicted 666
17 SASI_Hs01_00198327 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038727 predicted 446
2 SASI_Rn01_00038730 predicted 392
3 SASI_Rn01_00038731 predicted 593
4 SASI_Rn01_00038732 predicted 888
5 SASI_Rn01_00038733 predicted 483
6 SASI_Rn01_00038735 predicted 379
7 SASI_Rn01_00038736 predicted 745
8 SASI_Rn02_00204338 predicted 449
9 SASI_Rn02_00204339 predicted 717
10 SASI_Rn02_00204340 predicted 570
11 SASI_Rn01_00038728 predicted 1356
12 SASI_Rn01_00038729 predicted 1350
13 SASI_Rn01_00038734 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098828 predicted 1331
2 SASI_Mm01_00098829 predicted 308
3 SASI_Mm01_00098830 predicted 1348
4 SASI_Mm01_00098831 predicted 464
5 SASI_Mm01_00098832 predicted 717
6 SASI_Mm02_00345893 predicted 1327
7 SASI_Mm01_00098833 predicted 1358
8 SASI_Mm01_00098834 predicted 823
9 SASI_Mm01_00098835 predicted 234
10 SASI_Mm01_00098836 predicted 538
11 SASI_Mm01_00098837 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198403
MMD2 MISSION shRNA Bacterial Glycerol Stock
monocyte to macrophage differentiation-associated 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198403.3-318s21c1
Sequence:CCGGCCCATGCTTTCTGGATCATCCCTCGAGGGATGATCCAGAAAGCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198403.3-363s21c1
Sequence:CCGGTCTACTTCCTGTCGGACGATGCTCGAGCATCGTCCGACAGGAAGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198403.3-1167s21c1
Sequence:CCGGTTAGATGAGTGTTTCCTAATACTCGAGTATTAGGAAACACTCATCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198403.3-839s21c1
Sequence:CCGGTGGCATCTCTTTGTAGCATTTCTCGAGAAATGCTACAAAGAGATGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-514s1c1
Sequence:CCGGCGACCGGATGGTCATCTATTTCTCGAGAAATAGATGACCATCCGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-679s1c1
Sequence:CCGGGCTTCTCTGCTACGTCGTAATCTCGAGATTACGACGTAGCAGAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-281s1c1
Sequence:CCGGCAGCCCACAGAGTATGAACATCTCGAGATGTTCATACTCTGTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-226s1c1
Sequence:CCGGGAAGACGAAATACGCGAGGTTCTCGAGAACCTCGCGTATTTCGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198403
MMD2 MISSION shRNA shRNA Plasmid DNA
monocyte to macrophage differentiation-associated 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198403.3-318s21c1
Sequence:CCGGCCCATGCTTTCTGGATCATCCCTCGAGGGATGATCCAGAAAGCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198403.3-363s21c1
Sequence:CCGGTCTACTTCCTGTCGGACGATGCTCGAGCATCGTCCGACAGGAAGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198403.3-1167s21c1
Sequence:CCGGTTAGATGAGTGTTTCCTAATACTCGAGTATTAGGAAACACTCATCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198403.3-839s21c1
Sequence:CCGGTGGCATCTCTTTGTAGCATTTCTCGAGAAATGCTACAAAGAGATGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-514s1c1
Sequence:CCGGCGACCGGATGGTCATCTATTTCTCGAGAAATAGATGACCATCCGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-679s1c1
Sequence:CCGGGCTTCTCTGCTACGTCGTAATCTCGAGATTACGACGTAGCAGAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-281s1c1
Sequence:CCGGCAGCCCACAGAGTATGAACATCTCGAGATGTTCATACTCTGTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-226s1c1
Sequence:CCGGGAAGACGAAATACGCGAGGTTCTCGAGAACCTCGCGTATTTCGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198403
MMD2 MISSION shRNA Lentiviral Transduction Particles
monocyte to macrophage differentiation-associated 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198403.3-318s21c1
Sequence:CCGGCCCATGCTTTCTGGATCATCCCTCGAGGGATGATCCAGAAAGCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198403.3-363s21c1
Sequence:CCGGTCTACTTCCTGTCGGACGATGCTCGAGCATCGTCCGACAGGAAGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198403.3-1167s21c1
Sequence:CCGGTTAGATGAGTGTTTCCTAATACTCGAGTATTAGGAAACACTCATCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198403.3-839s21c1
Sequence:CCGGTGGCATCTCTTTGTAGCATTTCTCGAGAAATGCTACAAAGAGATGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-514s1c1
Sequence:CCGGCGACCGGATGGTCATCTATTTCTCGAGAAATAGATGACCATCCGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-679s1c1
Sequence:CCGGGCTTCTCTGCTACGTCGTAATCTCGAGATTACGACGTAGCAGAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-281s1c1
Sequence:CCGGCAGCCCACAGAGTATGAACATCTCGAGATGTTCATACTCTGTGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198403.2-226s1c1
Sequence:CCGGGAAGACGAAATACGCGAGGTTCTCGAGAACCTCGCGTATTTCGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175217
MMD2 MISSION shRNA Bacterial Glycerol Stock
monocyte to macrophage differentiation-associated 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175217.3-1060s1c1
Sequence:CCGGGCCCTTTCTATGGAGGAGAAACTCGAGTTTCTCCTCCATAGAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-466s1c1
Sequence:CCGGCGACAGGATGGTGATCTACTTCTCGAGAAGTAGATCACCATCCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-463s1c1
Sequence:CCGGGATCGACAGGATGGTGATCTACTCGAGTAGATCACCATCCTGTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-383s1c1
Sequence:CCGGCTCTTTGTGGTATCCACCATTCTCGAGAATGGTGGATACCACAAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-240s1c1
Sequence:CCGGCTGAGTATGAACACGCAGCAACTCGAGTTGCTGCGTGTTCATACTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175217
MMD2 MISSION shRNA shRNA Plasmid DNA
monocyte to macrophage differentiation-associated 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175217.3-1060s1c1
Sequence:CCGGGCCCTTTCTATGGAGGAGAAACTCGAGTTTCTCCTCCATAGAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-466s1c1
Sequence:CCGGCGACAGGATGGTGATCTACTTCTCGAGAAGTAGATCACCATCCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-463s1c1
Sequence:CCGGGATCGACAGGATGGTGATCTACTCGAGTAGATCACCATCCTGTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-383s1c1
Sequence:CCGGCTCTTTGTGGTATCCACCATTCTCGAGAATGGTGGATACCACAAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-240s1c1
Sequence:CCGGCTGAGTATGAACACGCAGCAACTCGAGTTGCTGCGTGTTCATACTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175217
MMD2 MISSION shRNA Lentiviral Transduction Particles
monocyte to macrophage differentiation-associated 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175217.3-1060s1c1
Sequence:CCGGGCCCTTTCTATGGAGGAGAAACTCGAGTTTCTCCTCCATAGAAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-466s1c1
Sequence:CCGGCGACAGGATGGTGATCTACTTCTCGAGAAGTAGATCACCATCCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-463s1c1
Sequence:CCGGGATCGACAGGATGGTGATCTACTCGAGTAGATCACCATCCTGTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-383s1c1
Sequence:CCGGCTCTTTGTGGTATCCACCATTCTCGAGAATGGTGGATACCACAAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175217.3-240s1c1
Sequence:CCGGCTGAGTATGAACACGCAGCAACTCGAGTTGCTGCGTGTTCATACTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)