EMAIL THIS PAGE TO A FRIEND

MMD

monocyte to macrophage differentiation-associated

200 Gene Product Result for
Synonyms: MMA MMD1 PAQR11
UniProtKB ID: Q15546, B2R6X9, D3DTY6, Q8TAN7
Gene ID:
Human(23531) Summary: This protein is expressed by in vitro differentiated macrophages but not freshly isolated monocytes. Although sequence analysis identifies seven potential transmembrane domains, this protein has little homology to G-protein receptors and it has not been positively identified as a receptor. A suggested alternative function is that of an ion channel protein in maturing macrophages. [provided by RefSeq, Jul 2008]
Mouse(67468) monocyte to macrophage differentiation-associated
Rat(303439) monocyte to macrophage differentiation-associated
Zebrafish(641478) monocyte to macrophage differentiation-associated
chicken(417397) monocyte to macrophage differentiation-associated
dog(480562) monocyte to macrophage differentiation-associated
domestic cat(101085331) monocyte to macrophage differentiation-associated
cow(513155) monocyte to macrophage differentiation-associated
fruit fly(32561) mind-meld
sheep(101120850) monocyte to macrophage differentiation-associated
domestic guinea pig(100734704) monocyte to macrophage differentiation-associated
naked mole-rat(101703899) monocyte to macrophage differentiation-associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012329 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012329 Rosetta Predictions human pricing
NM_001007673 Rosetta Predictions rat pricing
XM_001081244 Rosetta Predictions rat pricing
NM_026178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035155 predicted 573
2 SASI_Hs01_00035156 predicted 805
3 SASI_Hs01_00035157 predicted 802
4 SASI_Hs01_00035158 predicted 471
5 SASI_Hs01_00035159 predicted 607
6 SASI_Hs01_00035160 predicted 657
7 SASI_Hs01_00035161 predicted 850
8 SASI_Hs01_00035162 predicted 687
9 SASI_Hs01_00035163 predicted 495
10 SASI_Hs01_00035164 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046754 predicted 461
2 SASI_Rn01_00046755 predicted 368
3 SASI_Rn02_00198804 predicted 605
4 SASI_Rn01_00046757 predicted 226
5 SASI_Rn01_00046758 predicted 483
6 SASI_Rn01_00046759 predicted 197
7 SASI_Rn01_00046760 predicted 594
8 SASI_Rn01_00046761 predicted 263
9 SASI_Rn01_00046762 predicted 704
10 SASI_Rn01_00046763 predicted 684
11 SASI_Rn01_00046756 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371202 predicted 347
2 SASI_Rn02_00371203 predicted 257
3 SASI_Rn02_00371204 predicted 492
4 SASI_Rn02_00371205 predicted 365
5 SASI_Rn02_00371206 predicted 482
6 SASI_Rn02_00371207 predicted 587
7 SASI_Rn02_00371208 predicted 485
8 SASI_Rn02_00371209 predicted 573
9 SASI_Rn02_00371210 predicted 450
10 SASI_Rn02_00371211 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329818 predicted 601
2 SASI_Mm01_00192688 predicted 414
3 SASI_Mm01_00192689 predicted 279
4 SASI_Mm01_00192690 predicted 1414
5 SASI_Mm01_00192691 predicted 1302
6 SASI_Mm01_00192692 predicted 305
7 SASI_Mm01_00192693 predicted 1364
8 SASI_Mm01_00192694 predicted 674
9 SASI_Mm01_00192695 predicted 744
10 SASI_Mm01_00192696 predicted 288
11 SASI_Mm01_00192697 predicted 1433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026178
VALIDATED
MMD MISSION shRNA Bacterial Glycerol Stock
monocyte to macrophage differentiation-associated
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026178.2-308s21c1
Sequence:CCGGGCTACGAACATGCTGCCAATTCTCGAGAATTGGCAGCATGTTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-884s21c1
Sequence:CCGGCCGTACACTACTATGCCATTTCTCGAGAAATGGCATAGTAGTGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026178.2-461s1c1
Sequence:CCGGCCACAGTGTTTCACATAGTATCTCGAGATACTATGTGAAACACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026178.2-1898s1c1
Sequence:CCGGGCGAATTGTATTTGCCACTTTCTCGAGAAAGTGGCAAATACAATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026178.2-308s1c1
Sequence:CCGGGCTACGAACATGCTGCCAATTCTCGAGAATTGGCAGCATGTTCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026178.2-927s1c1
Sequence:CCGGCACAGACTTTATTCGGCATTTCTCGAGAAATGCCGAATAAAGTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026178.2-926s1c1
Sequence:CCGGCCACAGACTTTATTCGGCATTCTCGAGAATGCCGAATAAAGTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-926s21c1
Sequence:CCGGCCACAGACTTTATTCGGCATTCTCGAGAATGCCGAATAAAGTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-1432s21c1
Sequence:CCGGCTTGACATAACATGGTTATTTCTCGAGAAATAACCATGTTATGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-461s21c1
Sequence:CCGGCCACAGTGTTTCACATAGTATCTCGAGATACTATGTGAAACACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026178
VALIDATED
MMD MISSION shRNA shRNA Plasmid DNA
monocyte to macrophage differentiation-associated
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026178.2-308s21c1
Sequence:CCGGGCTACGAACATGCTGCCAATTCTCGAGAATTGGCAGCATGTTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-884s21c1
Sequence:CCGGCCGTACACTACTATGCCATTTCTCGAGAAATGGCATAGTAGTGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026178.2-461s1c1
Sequence:CCGGCCACAGTGTTTCACATAGTATCTCGAGATACTATGTGAAACACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026178.2-1898s1c1
Sequence:CCGGGCGAATTGTATTTGCCACTTTCTCGAGAAAGTGGCAAATACAATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026178.2-308s1c1
Sequence:CCGGGCTACGAACATGCTGCCAATTCTCGAGAATTGGCAGCATGTTCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026178.2-927s1c1
Sequence:CCGGCACAGACTTTATTCGGCATTTCTCGAGAAATGCCGAATAAAGTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026178.2-926s1c1
Sequence:CCGGCCACAGACTTTATTCGGCATTCTCGAGAATGCCGAATAAAGTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-926s21c1
Sequence:CCGGCCACAGACTTTATTCGGCATTCTCGAGAATGCCGAATAAAGTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-1432s21c1
Sequence:CCGGCTTGACATAACATGGTTATTTCTCGAGAAATAACCATGTTATGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-461s21c1
Sequence:CCGGCCACAGTGTTTCACATAGTATCTCGAGATACTATGTGAAACACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026178
VALIDATED
MMD MISSION shRNA Lentiviral Transduction Particles
monocyte to macrophage differentiation-associated
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026178.2-308s21c1
Sequence:CCGGGCTACGAACATGCTGCCAATTCTCGAGAATTGGCAGCATGTTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-884s21c1
Sequence:CCGGCCGTACACTACTATGCCATTTCTCGAGAAATGGCATAGTAGTGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026178.2-461s1c1
Sequence:CCGGCCACAGTGTTTCACATAGTATCTCGAGATACTATGTGAAACACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101365    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026178.2-1898s1c1
Sequence:CCGGGCGAATTGTATTTGCCACTTTCTCGAGAAAGTGGCAAATACAATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026178.2-308s1c1
Sequence:CCGGGCTACGAACATGCTGCCAATTCTCGAGAATTGGCAGCATGTTCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026178.2-927s1c1
Sequence:CCGGCACAGACTTTATTCGGCATTTCTCGAGAAATGCCGAATAAAGTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026178.2-926s1c1
Sequence:CCGGCCACAGACTTTATTCGGCATTCTCGAGAATGCCGAATAAAGTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-926s21c1
Sequence:CCGGCCACAGACTTTATTCGGCATTCTCGAGAATGCCGAATAAAGTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-1432s21c1
Sequence:CCGGCTTGACATAACATGGTTATTTCTCGAGAAATAACCATGTTATGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026178.2-461s21c1
Sequence:CCGGCCACAGTGTTTCACATAGTATCTCGAGATACTATGTGAAACACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012329
VALIDATED
MMD MISSION shRNA Bacterial Glycerol Stock
monocyte to macrophage differentiation-associated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012329.2-577s21c1
Sequence:CCGGATGTGTGATAGAATGGTTATCCTCGAGGATAACCATTCTATCACACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012329.2-1241s21c1
Sequence:CCGGGACTTGGCCAACTGATGTTTACTCGAGTAAACATCAGTTGGCCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012329.1-304s1c1
Sequence:CCGGGCTTCTACAGTATTTCACATTCTCGAGAATGTGAAATACTGTAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012329.1-421s1c1
Sequence:CCGGCCATGGTTAAATCTTCGTGAACTCGAGTTCACGAAGATTTAACCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012329.1-465s1c1
Sequence:CCGGGCGTTGGTTTATCTGGCTCATCTCGAGATGAGCCAGATAAACCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012329.1-765s1c1
Sequence:CCGGCCGAAGTCCTACGGACTTTATCTCGAGATAAAGTCCGTAGGACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012329.2-1316s21c1
Sequence:CCGGATTACTATGTCAGGTTGTAAACTCGAGTTTACAACCTGACATAGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012329.1-730s1c1
Sequence:CCGGGCAGTGCATTACTACGCCATTCTCGAGAATGGCGTAGTAATGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012329.2-874s21c1
Sequence:CCGGAGTGATGGCATCATTCCATTTCTCGAGAAATGGAATGATGCCATCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012329.2-1388s21c1
Sequence:CCGGCTTTCCCATTCACTAGGTAAACTCGAGTTTACCTAGTGAATGGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012329
VALIDATED
MMD MISSION shRNA shRNA Plasmid DNA
monocyte to macrophage differentiation-associated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012329.2-577s21c1
Sequence:CCGGATGTGTGATAGAATGGTTATCCTCGAGGATAACCATTCTATCACACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012329.2-1241s21c1
Sequence:CCGGGACTTGGCCAACTGATGTTTACTCGAGTAAACATCAGTTGGCCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012329.1-304s1c1
Sequence:CCGGGCTTCTACAGTATTTCACATTCTCGAGAATGTGAAATACTGTAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012329.1-421s1c1
Sequence:CCGGCCATGGTTAAATCTTCGTGAACTCGAGTTCACGAAGATTTAACCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012329.1-465s1c1
Sequence:CCGGGCGTTGGTTTATCTGGCTCATCTCGAGATGAGCCAGATAAACCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012329.1-765s1c1
Sequence:CCGGCCGAAGTCCTACGGACTTTATCTCGAGATAAAGTCCGTAGGACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012329.2-1316s21c1
Sequence:CCGGATTACTATGTCAGGTTGTAAACTCGAGTTTACAACCTGACATAGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012329.1-730s1c1
Sequence:CCGGGCAGTGCATTACTACGCCATTCTCGAGAATGGCGTAGTAATGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012329.2-874s21c1
Sequence:CCGGAGTGATGGCATCATTCCATTTCTCGAGAAATGGAATGATGCCATCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012329.2-1388s21c1
Sequence:CCGGCTTTCCCATTCACTAGGTAAACTCGAGTTTACCTAGTGAATGGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012329
VALIDATED
MMD MISSION shRNA Lentiviral Transduction Particles
monocyte to macrophage differentiation-associated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012329.2-577s21c1
Sequence:CCGGATGTGTGATAGAATGGTTATCCTCGAGGATAACCATTCTATCACACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012329.2-1241s21c1
Sequence:CCGGGACTTGGCCAACTGATGTTTACTCGAGTAAACATCAGTTGGCCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012329.1-304s1c1
Sequence:CCGGGCTTCTACAGTATTTCACATTCTCGAGAATGTGAAATACTGTAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012329.1-421s1c1
Sequence:CCGGCCATGGTTAAATCTTCGTGAACTCGAGTTCACGAAGATTTAACCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012329.1-465s1c1
Sequence:CCGGGCGTTGGTTTATCTGGCTCATCTCGAGATGAGCCAGATAAACCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012329.1-765s1c1
Sequence:CCGGCCGAAGTCCTACGGACTTTATCTCGAGATAAAGTCCGTAGGACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012329.2-1316s21c1
Sequence:CCGGATTACTATGTCAGGTTGTAAACTCGAGTTTACAACCTGACATAGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012329.1-730s1c1
Sequence:CCGGGCAGTGCATTACTACGCCATTCTCGAGAATGGCGTAGTAATGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012329.2-874s21c1
Sequence:CCGGAGTGATGGCATCATTCCATTTCTCGAGAAATGGAATGATGCCATCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012329.2-1388s21c1
Sequence:CCGGCTTTCCCATTCACTAGGTAAACTCGAGTTTACCTAGTGAATGGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)