EMAIL THIS PAGE TO A FRIEND

MME

membrane metallo-endopeptidase

108 Gene Product Result for
Synonyms: CALLA CD10 NEP SFE
UniProtKB ID: P08473, A8K6U6, D3DNJ9, Q3MIX4
Gene ID:
Human(4311) Summary: This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
Mouse(17380) membrane metallo endopeptidase
Rat(24590) membrane metallo-endopeptidase
chicken(425031) membrane metallo-endopeptidase
dog(477120) membrane metallo-endopeptidase
cow(536741) membrane metallo-endopeptidase
Horse(100053541) membrane metallo-endopeptidase
domestic cat(101087516) membrane metallo-endopeptidase
sheep(101112618) membrane metallo-endopeptidase
domestic guinea pig(100724320) membrane metallo-endopeptidase
naked mole-rat(101715828) membrane metallo-endopeptidase
Domestic Rabbit(100009251) membrane metallo-endopeptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300659 Anti-CD10 antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB5500034 Anti-CD10 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP179, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB5500035 Anti-CD10 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP67, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB1400166 Anti-MME antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1401246 Anti-MME antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA052583 Anti-MME antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA056072 Anti-MME antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB1306524 ANTI-NEPRILYSIN(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB4700436 Monoclonal Anti-CD10 antibody produced in mouse clone LT10, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700440 Monoclonal Anti-CD10 antibody produced in mouse clone MEM-78, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700441 Monoclonal Anti-CD10-APC antibody produced in mouse clone MEM-78, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700442 Monoclonal Anti-CD10-Biotin antibody produced in mouse clone MEM-78, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700438 Monoclonal Anti-CD10-FITC antibody produced in mouse clone LT10, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700443 Monoclonal Anti-CD10-FITC antibody produced in mouse clone MEM-78, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700439 Monoclonal Anti-CD10-PE antibody produced in mouse clone LT10, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700444 Monoclonal Anti-CD10-PE antibody produced in mouse clone MEM-78, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
482609 N-[(2S,3R)-3-Amino-2-hydroxy-4-phenylbutyryl]-L-leucine 97% human, mouse, rat pricing
T6031 DL-Thiorphan ≥98% (TLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000902 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000902 Rosetta Predictions human pricing
NM_007287 Rosetta Predictions human pricing
NM_007288 Rosetta Predictions human pricing
NM_007289 Rosetta Predictions human pricing
NM_012608 Rosetta Predictions rat pricing
NM_008604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177927 predicted 2463
2 SASI_Hs01_00177928 predicted 995
3 SASI_Hs01_00177929 predicted 2084
4 SASI_Hs02_00303469 predicted 2267
5 SASI_Hs01_00177930 predicted 977
6 SASI_Hs01_00177931 predicted 1892
7 SASI_Hs01_00177932 predicted 1423
8 SASI_Hs01_00177933 predicted 1403
9 SASI_Hs01_00177934 predicted 2212
10 SASI_Hs01_00177935 predicted 1561
11 SASI_Hs01_00177936 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041627 predicted 2448
2 SASI_Hs01_00041628 predicted 971
3 SASI_Hs01_00041629 predicted 2063
4 SASI_Hs02_00343359 predicted 2246
5 SASI_Hs01_00041630 predicted 948
6 SASI_Hs01_00041631 predicted 1868
7 SASI_Hs01_00041632 predicted 1399
8 SASI_Hs01_00041633 predicted 1387
9 SASI_Hs01_00041634 predicted 2191
10 SASI_Hs01_00041635 predicted 1534
11 SASI_Hs01_00041636 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191566 predicted 2489
2 SASI_Hs01_00191567 predicted 1018
3 SASI_Hs01_00191568 predicted 2106
4 SASI_Hs02_00343360 predicted 2290
5 SASI_Hs01_00191569 predicted 1003
6 SASI_Hs01_00191570 predicted 1915
7 SASI_Hs01_00191571 predicted 1442
8 SASI_Hs01_00191572 predicted 1432
9 SASI_Hs01_00191573 predicted 2233
10 SASI_Hs01_00191574 predicted 1582
11 SASI_Hs01_00191575 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140107 predicted 2532
2 SASI_Hs01_00140108 predicted 1067
3 SASI_Hs01_00140109 predicted 2155
4 SASI_Hs02_00343361 predicted 2336
5 SASI_Hs01_00140110 predicted 1043
6 SASI_Hs01_00140111 predicted 1960
7 SASI_Hs01_00140112 predicted 1490
8 SASI_Hs01_00140113 predicted 1476
9 SASI_Hs01_00140114 predicted 2286
10 SASI_Hs01_00140115 predicted 1625
11 SASI_Hs01_00140116 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110662 predicted 1086
2 SASI_Rn01_00110663 predicted 814
3 SASI_Rn01_00110664 predicted 1714
4 SASI_Rn01_00110665 predicted 749
5 SASI_Rn01_00110666 predicted 1120
6 SASI_Rn01_00110667 predicted 2048
7 SASI_Rn02_00259793 predicted 2098
8 SASI_Rn01_00110668 predicted 1188
9 SASI_Rn02_00259794 predicted 360
10 SASI_Rn01_00110669 predicted 1243
11 SASI_Rn01_00110670 predicted 2364
12 SASI_Rn01_00110671 predicted 1183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181521 predicted 1071
2 SASI_Mm01_00181522 predicted 2188
3 SASI_Mm01_00181523 predicted 1147
4 SASI_Mm01_00181524 predicted 1857
5 SASI_Mm02_00314266 predicted 1200
6 SASI_Mm01_00181525 predicted 1829
7 SASI_Mm01_00181526 predicted 1651
8 SASI_Mm01_00181527 predicted 2291
9 SASI_Mm01_00181528 predicted 289
10 SASI_Mm02_00314267 predicted 1601
11 SASI_Mm01_00181520 predicted 714
12 SASI_Mm01_00181529 predicted 1677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008604
MME MISSION shRNA Bacterial Glycerol Stock
membrane metallo-endopeptidase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008604.3-1044s21c1
Sequence:CCGGAGTCATTCAGCTGGTCAAATTCTCGAGAATTTGACCAGCTGAATGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008604.3-1197s21c1
Sequence:CCGGTAATGTCCTGGAGGTTCATAACTCGAGTTATGAACCTCCAGGACATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-237s1c1
Sequence:CCGGGCAACCTATGATGATGGCATTCTCGAGAATGCCATCATCATAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-1825s1c1
Sequence:CCGGGCATGGTCATTGGACATGAAACTCGAGTTTCATGTCCAATGACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-2283s1c1
Sequence:CCGGGCCTTTCATTGCCGCAAGAATCTCGAGATTCTTGCGGCAATGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008604.2-2866s1c1
Sequence:CCGGCCCACATCAATTTAGTTTGAACTCGAGTTCAAACTAAATTGATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-1317s1c1
Sequence:CCGGCGGTGTGCTAACTACGTCAATCTCGAGATTGACGTAGTTAGCACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008604.3-561s21c1
Sequence:CCGGTCAAACTGTTACCAGATATATCTCGAGATATATCTGGTAACAGTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008604
MME MISSION shRNA shRNA Plasmid DNA
membrane metallo-endopeptidase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008604.3-1044s21c1
Sequence:CCGGAGTCATTCAGCTGGTCAAATTCTCGAGAATTTGACCAGCTGAATGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008604.3-1197s21c1
Sequence:CCGGTAATGTCCTGGAGGTTCATAACTCGAGTTATGAACCTCCAGGACATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-237s1c1
Sequence:CCGGGCAACCTATGATGATGGCATTCTCGAGAATGCCATCATCATAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-1825s1c1
Sequence:CCGGGCATGGTCATTGGACATGAAACTCGAGTTTCATGTCCAATGACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-2283s1c1
Sequence:CCGGGCCTTTCATTGCCGCAAGAATCTCGAGATTCTTGCGGCAATGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008604.2-2866s1c1
Sequence:CCGGCCCACATCAATTTAGTTTGAACTCGAGTTCAAACTAAATTGATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-1317s1c1
Sequence:CCGGCGGTGTGCTAACTACGTCAATCTCGAGATTGACGTAGTTAGCACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008604.3-561s21c1
Sequence:CCGGTCAAACTGTTACCAGATATATCTCGAGATATATCTGGTAACAGTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008604
MME MISSION shRNA Lentiviral Transduction Particles
membrane metallo-endopeptidase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008604.3-1044s21c1
Sequence:CCGGAGTCATTCAGCTGGTCAAATTCTCGAGAATTTGACCAGCTGAATGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008604.3-1197s21c1
Sequence:CCGGTAATGTCCTGGAGGTTCATAACTCGAGTTATGAACCTCCAGGACATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-237s1c1
Sequence:CCGGGCAACCTATGATGATGGCATTCTCGAGAATGCCATCATCATAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-1825s1c1
Sequence:CCGGGCATGGTCATTGGACATGAAACTCGAGTTTCATGTCCAATGACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-2283s1c1
Sequence:CCGGGCCTTTCATTGCCGCAAGAATCTCGAGATTCTTGCGGCAATGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008604.2-2866s1c1
Sequence:CCGGCCCACATCAATTTAGTTTGAACTCGAGTTCAAACTAAATTGATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008604.2-1317s1c1
Sequence:CCGGCGGTGTGCTAACTACGTCAATCTCGAGATTGACGTAGTTAGCACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008604.3-561s21c1
Sequence:CCGGTCAAACTGTTACCAGATATATCTCGAGATATATCTGGTAACAGTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000902
VALIDATED
MME MISSION shRNA Bacterial Glycerol Stock
membrane metallo-endopeptidase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-2238s1c1
Sequence:CCGGCCAGGCAATTTCAGGATTATTCTCGAGAATAATCCTGAAATTGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-1332s1c1
Sequence:CCGGGCAAACTATGTCAATGGGAATCTCGAGATTCCCATTGACATAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-855s1c1
Sequence:CCGGGCCAGATTGATTCGTCAGGAACTCGAGTTCCTGACGAATCAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-1834s1c1
Sequence:CCGGGCATGGTCATAGGACACGAAACTCGAGTTTCGTGTCCTATGACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-268s1c1
Sequence:CCGGGCAAGTCATCAGACTGCATAACTCGAGTTATGCAGTCTGATGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000902.3-1229s21c1
Sequence:CCGCTAATGTCCTGGAGATTCATAACTCGAGTTATGAATCTCCAGGACATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000902.3-2771s21c1
Sequence:CCGGTAGGTGACACTATAGTTTAAACTCGAGTTTAAACTATAGTGTCACCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000902.3-2563s21c1
Sequence:CCGGCTAAGGTCTATCAAGTCAATCCTCGAGGATTGACTTGATAGACCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000902
VALIDATED
MME MISSION shRNA shRNA Plasmid DNA
membrane metallo-endopeptidase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-2238s1c1
Sequence:CCGGCCAGGCAATTTCAGGATTATTCTCGAGAATAATCCTGAAATTGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-1332s1c1
Sequence:CCGGGCAAACTATGTCAATGGGAATCTCGAGATTCCCATTGACATAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-855s1c1
Sequence:CCGGGCCAGATTGATTCGTCAGGAACTCGAGTTCCTGACGAATCAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-1834s1c1
Sequence:CCGGGCATGGTCATAGGACACGAAACTCGAGTTTCGTGTCCTATGACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-268s1c1
Sequence:CCGGGCAAGTCATCAGACTGCATAACTCGAGTTATGCAGTCTGATGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000902.3-1229s21c1
Sequence:CCGCTAATGTCCTGGAGATTCATAACTCGAGTTATGAATCTCCAGGACATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000902.3-2771s21c1
Sequence:CCGGTAGGTGACACTATAGTTTAAACTCGAGTTTAAACTATAGTGTCACCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000902.3-2563s21c1
Sequence:CCGGCTAAGGTCTATCAAGTCAATCCTCGAGGATTGACTTGATAGACCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000902
VALIDATED
MME MISSION shRNA Lentiviral Transduction Particles
membrane metallo-endopeptidase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-2238s1c1
Sequence:CCGGCCAGGCAATTTCAGGATTATTCTCGAGAATAATCCTGAAATTGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-1332s1c1
Sequence:CCGGGCAAACTATGTCAATGGGAATCTCGAGATTCCCATTGACATAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-855s1c1
Sequence:CCGGGCCAGATTGATTCGTCAGGAACTCGAGTTCCTGACGAATCAATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-1834s1c1
Sequence:CCGGGCATGGTCATAGGACACGAAACTCGAGTTTCGTGTCCTATGACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000902.2-268s1c1
Sequence:CCGGGCAAGTCATCAGACTGCATAACTCGAGTTATGCAGTCTGATGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000902.3-1229s21c1
Sequence:CCGCTAATGTCCTGGAGATTCATAACTCGAGTTATGAATCTCCAGGACATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000902.3-2771s21c1
Sequence:CCGGTAGGTGACACTATAGTTTAAACTCGAGTTTAAACTATAGTGTCACCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000902.3-2563s21c1
Sequence:CCGGCTAAGGTCTATCAAGTCAATCCTCGAGGATTGACTTGATAGACCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)