EMAIL THIS PAGE TO A FRIEND

MMEL1

membrane metallo-endopeptidase-like 1

51 Gene Product Result for
Synonyms: MMEL2 NEP2 NEPII NL1 NL2 SEP
UniProtKB ID: Q495T6, B9DI79, Q495T7, Q495T8, Q5SZS6, Q96PH9
Gene ID:
Human(79258) Summary: The protein encoded by this gene is a member of the neutral endopeptidase (NEP) or membrane metallo-endopeptidase (MME) family. Family members play important roles in pain perception, arterial pressure regulation, phosphate metabolism and homeostasis. This protein is a type II transmembrane protein and is thought to be expressed as a secreted protein. This gene is expressed mainly in testis with weak expression in the brain, kidney, and heart. [provided by RefSeq, Jul 2008]
Mouse(27390) membrane metallo-endopeptidase-like 1
Rat(313755) membrane metallo-endopeptidase-like 1
Zebrafish(560703) membrane metallo-endopeptidase-like 1
chicken(770671) membrane metallo-endopeptidase-like 1
dog(489617) membrane metallo-endopeptidase-like 1
Horse(100054362) membrane metallo-endopeptidase-like 1
cow(616991) membrane metallo-endopeptidase-like 1
domestic cat(101090372) membrane metallo-endopeptidase-like 1
naked mole-rat(101723792) membrane metallo-endopeptidase-like 1
domestic guinea pig(100724882) membrane metallo-endopeptidase-like 1
sheep(101120510) membrane metallo-endopeptidase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033467 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013783 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013783 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013783 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033467 Rosetta Predictions human pricing
NM_001107997 Rosetta Predictions rat pricing
NM_013783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059226 predicted 2214
2 SASI_Hs01_00059227 predicted 1400
3 SASI_Hs01_00059228 predicted 1467
4 SASI_Hs02_00361345 predicted 2214
5 SASI_Hs01_00059229 predicted 1395
6 SASI_Hs01_00059230 predicted 1324
7 SASI_Hs01_00059231 predicted 1465
8 SASI_Hs01_00059232 predicted 2059
9 SASI_Hs01_00059233 predicted 2357
10 SASI_Hs01_00059234 predicted 1142
11 SASI_Hs01_00059235 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234345 predicted 2129
2 SASI_Rn02_00234346 predicted 665
3 SASI_Rn02_00234347 predicted 2150
4 SASI_Rn02_00234348 predicted 2474
5 SASI_Rn02_00234349 predicted 2562
6 SASI_Rn02_00234350 predicted 480
7 SASI_Rn02_00234351 predicted 2143
8 SASI_Rn02_00234352 predicted 1725
9 SASI_Rn02_00234353 predicted 2374
10 SASI_Rn02_00234354 predicted 1887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029120 predicted 2272
2 SASI_Mm01_00029121 predicted 798
3 SASI_Mm01_00029122 predicted 2250
4 SASI_Mm01_00029123 predicted 1283
5 SASI_Mm01_00029124 predicted 2232
6 SASI_Mm01_00029125 predicted 947
7 SASI_Mm02_00322737 predicted 793
8 SASI_Mm01_00029128 predicted 1861
9 SASI_Mm01_00029129 predicted 1792
10 SASI_Mm02_00322738 predicted 2145
11 SASI_Mm01_00029126 predicted 643
12 SASI_Mm01_00029127 predicted 1092
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033467
MMEL1 MISSION shRNA Bacterial Glycerol Stock
membrane metallo-endopeptidase-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033467.3-948s21c1
Sequence:CCGGGCCGGCACATCATCTACATAGCTCGAGCTATGTAGATGATGTGCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033467.3-2352s21c1
Sequence:CCGGAGCTCTTCTTCATCAACTATGCTCGAGCATAGTTGATGAAGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-1766s1c1
Sequence:CCGGCCAAACCGAAACCAGATTGTACTCGAGTACAATCTGGTTTCGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-424s1c1
Sequence:CCGGCCCTGAGACCAACTCAAGATACTCGAGTATCTTGAGTTGGTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-371s1c1
Sequence:CCGGTGTGACGACTTCTACCAGTTTCTCGAGAAACTGGTAGAAGTCGTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-1094s1c1
Sequence:CCGGCTGTTCATACAAACTGTGCTACTCGAGTAGCACAGTTTGTATGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-1975s1c1
Sequence:CCGGGCAGTCAGAGTGCATGATCTACTCGAGTAGATCATGCACTCTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033467.3-1244s21c1
Sequence:CCGGTTTGGCCTGAAGGGATTTAACCTCGAGGTTAAATCCCTTCAGGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033467
MMEL1 MISSION shRNA shRNA Plasmid DNA
membrane metallo-endopeptidase-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033467.3-948s21c1
Sequence:CCGGGCCGGCACATCATCTACATAGCTCGAGCTATGTAGATGATGTGCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033467.3-2352s21c1
Sequence:CCGGAGCTCTTCTTCATCAACTATGCTCGAGCATAGTTGATGAAGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-1766s1c1
Sequence:CCGGCCAAACCGAAACCAGATTGTACTCGAGTACAATCTGGTTTCGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-424s1c1
Sequence:CCGGCCCTGAGACCAACTCAAGATACTCGAGTATCTTGAGTTGGTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-371s1c1
Sequence:CCGGTGTGACGACTTCTACCAGTTTCTCGAGAAACTGGTAGAAGTCGTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-1094s1c1
Sequence:CCGGCTGTTCATACAAACTGTGCTACTCGAGTAGCACAGTTTGTATGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-1975s1c1
Sequence:CCGGGCAGTCAGAGTGCATGATCTACTCGAGTAGATCATGCACTCTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033467.3-1244s21c1
Sequence:CCGGTTTGGCCTGAAGGGATTTAACCTCGAGGTTAAATCCCTTCAGGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033467
MMEL1 MISSION shRNA Lentiviral Transduction Particles
membrane metallo-endopeptidase-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033467.3-948s21c1
Sequence:CCGGGCCGGCACATCATCTACATAGCTCGAGCTATGTAGATGATGTGCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033467.3-2352s21c1
Sequence:CCGGAGCTCTTCTTCATCAACTATGCTCGAGCATAGTTGATGAAGAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-1766s1c1
Sequence:CCGGCCAAACCGAAACCAGATTGTACTCGAGTACAATCTGGTTTCGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-424s1c1
Sequence:CCGGCCCTGAGACCAACTCAAGATACTCGAGTATCTTGAGTTGGTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-371s1c1
Sequence:CCGGTGTGACGACTTCTACCAGTTTCTCGAGAAACTGGTAGAAGTCGTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-1094s1c1
Sequence:CCGGCTGTTCATACAAACTGTGCTACTCGAGTAGCACAGTTTGTATGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033467.1-1975s1c1
Sequence:CCGGGCAGTCAGAGTGCATGATCTACTCGAGTAGATCATGCACTCTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033467.3-1244s21c1
Sequence:CCGGTTTGGCCTGAAGGGATTTAACCTCGAGGTTAAATCCCTTCAGGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013783
MMEL1 MISSION shRNA Bacterial Glycerol Stock
membrane metallo-endopeptidase-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-2029s1c1
Sequence:CCGGCCAACCACAGTCCTTGAATTTCTCGAGAAATTCAAGGACTGTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-2176s1c1
Sequence:CCGGGCAGTCGCAATGCATGATCTACTCGAGTAGATCATGCATTGCGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-1419s1c1
Sequence:CCGGCCATGCAGAACTACCTGGTATCTCGAGATACCAGGTAGTTCTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-380s1c1
Sequence:CCGGCTGGGTGTCTTCTACAGCATACTCGAGTATGCTGTAGAAGACACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-1855s1c1
Sequence:CCGGCGGACTTCAGAACCTCAAGAACTCGAGTTCTTGAGGTTCTGAAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013783
MMEL1 MISSION shRNA shRNA Plasmid DNA
membrane metallo-endopeptidase-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-2029s1c1
Sequence:CCGGCCAACCACAGTCCTTGAATTTCTCGAGAAATTCAAGGACTGTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-2176s1c1
Sequence:CCGGGCAGTCGCAATGCATGATCTACTCGAGTAGATCATGCATTGCGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-1419s1c1
Sequence:CCGGCCATGCAGAACTACCTGGTATCTCGAGATACCAGGTAGTTCTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-380s1c1
Sequence:CCGGCTGGGTGTCTTCTACAGCATACTCGAGTATGCTGTAGAAGACACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-1855s1c1
Sequence:CCGGCGGACTTCAGAACCTCAAGAACTCGAGTTCTTGAGGTTCTGAAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013783
MMEL1 MISSION shRNA Lentiviral Transduction Particles
membrane metallo-endopeptidase-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-2029s1c1
Sequence:CCGGCCAACCACAGTCCTTGAATTTCTCGAGAAATTCAAGGACTGTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-2176s1c1
Sequence:CCGGGCAGTCGCAATGCATGATCTACTCGAGTAGATCATGCATTGCGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-1419s1c1
Sequence:CCGGCCATGCAGAACTACCTGGTATCTCGAGATACCAGGTAGTTCTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-380s1c1
Sequence:CCGGCTGGGTGTCTTCTACAGCATACTCGAGTATGCTGTAGAAGACACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013783.1-1855s1c1
Sequence:CCGGCGGACTTCAGAACCTCAAGAACTCGAGTTCTTGAGGTTCTGAAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)