EMAIL THIS PAGE TO A FRIEND

MMGT1

membrane magnesium transporter 1

218 Gene Product Result for
Synonyms: EMC5 TMEM32
UniProtKB ID: Q8N4V1, B2R625, B4DIY3, D3DWG7, Q5JPP7
Gene ID:
Mouse(236792) membrane magnesium transporter 1
Rat(302864) membrane magnesium transporter 1
sheep(101105307) membrane magnesium transporter 1
domestic guinea pig(100734880) membrane magnesium transporter 1
Zebrafish(402891) membrane magnesium transporter 1
cow(617557) membrane magnesium transporter 1
domestic cat(101097549) membrane magnesium transporter 1
dog(611935) membrane magnesium transporter 1
chicken(422240) membrane magnesium transporter 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173470 Rosetta Predictions human pricing
NM_001106970 Rosetta Predictions rat pricing
NM_146234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068979 predicted 472
2 SASI_Hs01_00068980 predicted 454
3 SASI_Hs01_00068981 predicted 385
4 SASI_Hs01_00068982 predicted 443
5 SASI_Hs01_00068983 predicted 371
6 SASI_Hs02_00368215 predicted 450
7 SASI_Hs01_00068984 predicted 874
8 SASI_Hs01_00068985 predicted 405
9 SASI_Hs01_00068986 predicted 724
10 SASI_Hs01_00068987 predicted 415
11 SASI_Hs01_00068988 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224206 predicted 290
2 SASI_Rn02_00224207 predicted 234
3 SASI_Rn02_00224208 predicted 673
4 SASI_Rn02_00224209 predicted 466
5 SASI_Rn02_00224210 predicted 445
6 SASI_Rn02_00224211 predicted 621
7 SASI_Rn02_00224212 predicted 474
8 SASI_Rn02_00224213 predicted 460
9 SASI_Rn02_00224214 predicted 686
10 SASI_Rn02_00224215 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080059 predicted 383
2 SASI_Mm01_00080060 predicted 394
3 SASI_Mm01_00080061 predicted 219
4 SASI_Mm01_00080062 predicted 602
5 SASI_Mm01_00080063 predicted 591
6 SASI_Mm01_00080064 predicted 595
7 SASI_Mm01_00080065 predicted 193
8 SASI_Mm01_00080066 predicted 516
9 SASI_Mm01_00080067 predicted 538
10 SASI_Mm01_00080068 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173470
MMGT1 MISSION shRNA Bacterial Glycerol Stock
membrane magnesium transporter 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-633s1c1
Sequence:CCGGCCAAGATGCATTGTCCTCTAACTCGAGTTAGAGGACAATGCATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-378s1c1
Sequence:CCGGGCATCGTTCTTATATGCGATTCTCGAGAATCGCATATAAGAACGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-645s1c1
Sequence:CCGGGTCCTCTAACACATCATTGAACTCGAGTTCAATGATGTGTTAGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-611s1c1
Sequence:CCGGCGGATACAGCAAATTCTTCAACTCGAGTTGAAGAATTTGCTGTATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173470.1-3170s1c1
Sequence:CCGGGCGTTGTAACACTGCTAAATACTCGAGTATTTAGCAGTGTTACAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-608s1c1
Sequence:CCGGCTTCGGATACAGCAAATTCTTCTCGAGAAGAATTTGCTGTATCCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173470.1-2254s1c1
Sequence:CCGGCGGGTTAAAGTGATGATGATACTCGAGTATCATCATCACTTTAACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-574s1c1
Sequence:CCGGGTATTTAATCATCGTGGTCGACTCGAGTCGACCACGATGATTAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173470.1-2833s1c1
Sequence:CCGGCCGTGAATCTTATGCTGAGTACTCGAGTACTCAGCATAAGATTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173470
MMGT1 MISSION shRNA shRNA Plasmid DNA
membrane magnesium transporter 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-633s1c1
Sequence:CCGGCCAAGATGCATTGTCCTCTAACTCGAGTTAGAGGACAATGCATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-378s1c1
Sequence:CCGGGCATCGTTCTTATATGCGATTCTCGAGAATCGCATATAAGAACGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-645s1c1
Sequence:CCGGGTCCTCTAACACATCATTGAACTCGAGTTCAATGATGTGTTAGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-611s1c1
Sequence:CCGGCGGATACAGCAAATTCTTCAACTCGAGTTGAAGAATTTGCTGTATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173470.1-3170s1c1
Sequence:CCGGGCGTTGTAACACTGCTAAATACTCGAGTATTTAGCAGTGTTACAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-608s1c1
Sequence:CCGGCTTCGGATACAGCAAATTCTTCTCGAGAAGAATTTGCTGTATCCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173470.1-2254s1c1
Sequence:CCGGCGGGTTAAAGTGATGATGATACTCGAGTATCATCATCACTTTAACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-574s1c1
Sequence:CCGGGTATTTAATCATCGTGGTCGACTCGAGTCGACCACGATGATTAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173470.1-2833s1c1
Sequence:CCGGCCGTGAATCTTATGCTGAGTACTCGAGTACTCAGCATAAGATTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173470
MMGT1 MISSION shRNA Lentiviral Transduction Particles
membrane magnesium transporter 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-633s1c1
Sequence:CCGGCCAAGATGCATTGTCCTCTAACTCGAGTTAGAGGACAATGCATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-378s1c1
Sequence:CCGGGCATCGTTCTTATATGCGATTCTCGAGAATCGCATATAAGAACGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-645s1c1
Sequence:CCGGGTCCTCTAACACATCATTGAACTCGAGTTCAATGATGTGTTAGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-611s1c1
Sequence:CCGGCGGATACAGCAAATTCTTCAACTCGAGTTGAAGAATTTGCTGTATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173470.1-3170s1c1
Sequence:CCGGGCGTTGTAACACTGCTAAATACTCGAGTATTTAGCAGTGTTACAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-608s1c1
Sequence:CCGGCTTCGGATACAGCAAATTCTTCTCGAGAAGAATTTGCTGTATCCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173470.1-2254s1c1
Sequence:CCGGCGGGTTAAAGTGATGATGATACTCGAGTATCATCATCACTTTAACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173470.1-574s1c1
Sequence:CCGGGTATTTAATCATCGTGGTCGACTCGAGTCGACCACGATGATTAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148713    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173470.1-2833s1c1
Sequence:CCGGCCGTGAATCTTATGCTGAGTACTCGAGTACTCAGCATAAGATTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146234
VALIDATED
MMGT1 MISSION shRNA Bacterial Glycerol Stock
membrane magnesium transporter 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146234.3-393s1c1
Sequence:CCGGGATGCATTGTCCTCTAATACACTCGAGTGTATTAGAGGACAATGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146234.3-360s21c1
Sequence:CCGGCGGCCTTCAGATGCAACAAATCTCGAGATTTGTTGCATCTGAAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146234.3-224s21c1
Sequence:CCGGCTGTTATGGCATAGTTCATATCTCGAGATATGAACTATGCCATAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146234.2-3872s1c1
Sequence:CCGGGCACAATAACTCCCTAATAATCTCGAGATTATTAGGGAGTTATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146234.3-126s21c1
Sequence:CCGGGCTGCGCAGCATCGTTCTTATCTCGAGATAAGAACGATGCTGCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146234.3-791s21c1
Sequence:CCGGGAATCCTGGAAATACCATATACTCGAGTATATGGTATTTCCAGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146234.3-415s21c1
Sequence:CCGGCGTTGAAGTTACGAAAGTTTGCTCGAGCAAACTTTCGTAACTTCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146234
VALIDATED
MMGT1 MISSION shRNA shRNA Plasmid DNA
membrane magnesium transporter 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146234.3-393s1c1
Sequence:CCGGGATGCATTGTCCTCTAATACACTCGAGTGTATTAGAGGACAATGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146234.3-360s21c1
Sequence:CCGGCGGCCTTCAGATGCAACAAATCTCGAGATTTGTTGCATCTGAAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146234.3-224s21c1
Sequence:CCGGCTGTTATGGCATAGTTCATATCTCGAGATATGAACTATGCCATAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146234.2-3872s1c1
Sequence:CCGGGCACAATAACTCCCTAATAATCTCGAGATTATTAGGGAGTTATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146234.3-126s21c1
Sequence:CCGGGCTGCGCAGCATCGTTCTTATCTCGAGATAAGAACGATGCTGCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146234.3-791s21c1
Sequence:CCGGGAATCCTGGAAATACCATATACTCGAGTATATGGTATTTCCAGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146234.3-415s21c1
Sequence:CCGGCGTTGAAGTTACGAAAGTTTGCTCGAGCAAACTTTCGTAACTTCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146234
VALIDATED
MMGT1 MISSION shRNA Lentiviral Transduction Particles
membrane magnesium transporter 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146234.3-393s1c1
Sequence:CCGGGATGCATTGTCCTCTAATACACTCGAGTGTATTAGAGGACAATGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146234.3-360s21c1
Sequence:CCGGCGGCCTTCAGATGCAACAAATCTCGAGATTTGTTGCATCTGAAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146234.3-224s21c1
Sequence:CCGGCTGTTATGGCATAGTTCATATCTCGAGATATGAACTATGCCATAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146234.2-3872s1c1
Sequence:CCGGGCACAATAACTCCCTAATAATCTCGAGATTATTAGGGAGTTATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146234.3-126s21c1
Sequence:CCGGGCTGCGCAGCATCGTTCTTATCTCGAGATAAGAACGATGCTGCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248927    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146234.3-791s21c1
Sequence:CCGGGAATCCTGGAAATACCATATACTCGAGTATATGGTATTTCCAGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146234.3-415s21c1
Sequence:CCGGCGTTGAAGTTACGAAAGTTTGCTCGAGCAAACTTTCGTAACTTCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)