EMAIL THIS PAGE TO A FRIEND

MMP10

matrix metallopeptidase 10 (stromelysin 2)

57 Gene Product Result for
Synonyms: SL-2 STMY2
UniProtKB ID: P09238, B2R9X9, Q53HH9
Gene ID:
Human(4319) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The enzyme encoded by this gene degrades proteoglycans and fibronectin. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008]
Mouse(17384) matrix metallopeptidase 10
Rat(117061) matrix metallopeptidase 10 (stromelysin 2)
chicken(418981) matrix metallopeptidase 10 (stromelysin 2)
domestic cat(101081247) matrix metallopeptidase 10 (stromelysin 2)
naked mole-rat(101697990) matrix metallopeptidase 10 (stromelysin 2)
domestic guinea pig(100727690) matrix metallopeptidase 10 (stromelysin 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002425 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106591 MISSION® esiRNA esiRNA human MMP10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002425 Rosetta Predictions human pricing
NM_133514 Rosetta Predictions rat pricing
NM_019471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222821 predicted 625
2 SASI_Hs01_00222822 predicted 1111
3 SASI_Hs01_00222823 predicted 495
4 SASI_Hs01_00222825 predicted 596
5 SASI_Hs01_00222827 predicted 1435
6 SASI_Hs01_00222828 predicted 1111
7 SASI_Hs01_00222829 predicted 1126
8 SASI_Hs01_00222830 predicted 1509
9 SASI_Hs01_00222826 predicted 1319
10 SASI_Hs02_00333822 predicted 1540
11 SASI_Hs01_00222824 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133514 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065132 predicted 1150
2 SASI_Rn01_00065133 predicted 1061
3 SASI_Rn02_00267694 predicted 1257
4 SASI_Rn01_00065134 predicted 1265
5 SASI_Rn01_00065135 predicted 1228
6 SASI_Rn01_00065136 predicted 1304
7 SASI_Rn01_00065137 predicted 1350
8 SASI_Rn01_00065138 predicted 1464
9 SASI_Rn01_00065139 predicted 1275
10 SASI_Rn01_00065140 predicted 1346
11 SASI_Rn01_00065141 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324471 predicted 950
2 SASI_Mm01_00117133 predicted 1268
3 SASI_Mm01_00117134 predicted 1278
4 SASI_Mm01_00117135 predicted 714
5 SASI_Mm01_00117136 predicted 707
6 SASI_Mm01_00117137 predicted 809
7 SASI_Mm01_00117138 predicted 627
8 SASI_Mm01_00117139 predicted 774
9 SASI_Mm01_00117140 predicted 1352
10 SASI_Mm01_00117141 predicted 614
11 SASI_Mm01_00117142 predicted 1354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002425
MMP10 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 10 (stromelysin 2)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002425.1-497s21c1
Sequence:CCGGATGATCTCTTTCGCAGTTAAACTCGAGTTTAACTGCGAAAGAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-584s1c1
Sequence:CCGGCCTGGGCTTTATGGAGATATTCTCGAGAATATCTCCATAAAGCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-1018s1c1
Sequence:CCGGGCCCTCTCTTCCATCATATTTCTCGAGAAATATGATGGAAGAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-1298s1c1
Sequence:CCGGGCTGATGACTTTCCAGGAGTTCTCGAGAACTCCTGGAAAGTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-183s1c1
Sequence:CCGGAGGACAGTAATCTCATTGTTACTCGAGTAACAATGAGATTACTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-416s1c1
Sequence:CCGGGCCATTGAGAAAGCTCTGAAACTCGAGTTTCAGAGCTTTCTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002425.1-636s21c1
Sequence:CCGGATGCATCAGGCACCAATTTATCTCGAGATAAATTGGTGCCTGATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002425.1-1276s21c1
Sequence:CCGGGCAAGGCTTCCCTAGACTAATCTCGAGATTAGTCTAGGGAAGCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002425
MMP10 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 10 (stromelysin 2)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002425.1-497s21c1
Sequence:CCGGATGATCTCTTTCGCAGTTAAACTCGAGTTTAACTGCGAAAGAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-584s1c1
Sequence:CCGGCCTGGGCTTTATGGAGATATTCTCGAGAATATCTCCATAAAGCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-1018s1c1
Sequence:CCGGGCCCTCTCTTCCATCATATTTCTCGAGAAATATGATGGAAGAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-1298s1c1
Sequence:CCGGGCTGATGACTTTCCAGGAGTTCTCGAGAACTCCTGGAAAGTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-183s1c1
Sequence:CCGGAGGACAGTAATCTCATTGTTACTCGAGTAACAATGAGATTACTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-416s1c1
Sequence:CCGGGCCATTGAGAAAGCTCTGAAACTCGAGTTTCAGAGCTTTCTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002425.1-636s21c1
Sequence:CCGGATGCATCAGGCACCAATTTATCTCGAGATAAATTGGTGCCTGATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002425.1-1276s21c1
Sequence:CCGGGCAAGGCTTCCCTAGACTAATCTCGAGATTAGTCTAGGGAAGCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002425
MMP10 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 10 (stromelysin 2)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002425.1-497s21c1
Sequence:CCGGATGATCTCTTTCGCAGTTAAACTCGAGTTTAACTGCGAAAGAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-584s1c1
Sequence:CCGGCCTGGGCTTTATGGAGATATTCTCGAGAATATCTCCATAAAGCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-1018s1c1
Sequence:CCGGGCCCTCTCTTCCATCATATTTCTCGAGAAATATGATGGAAGAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-1298s1c1
Sequence:CCGGGCTGATGACTTTCCAGGAGTTCTCGAGAACTCCTGGAAAGTCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-183s1c1
Sequence:CCGGAGGACAGTAATCTCATTGTTACTCGAGTAACAATGAGATTACTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002425.1-416s1c1
Sequence:CCGGGCCATTGAGAAAGCTCTGAAACTCGAGTTTCAGAGCTTTCTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002425.1-636s21c1
Sequence:CCGGATGCATCAGGCACCAATTTATCTCGAGATAAATTGGTGCCTGATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002425.1-1276s21c1
Sequence:CCGGGCAAGGCTTCCCTAGACTAATCTCGAGATTAGTCTAGGGAAGCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019471
MMP10 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 10 (stromelysin 2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-1329s1c1
Sequence:CCGGCCAGGAATTGAGCCACAAGTTCTCGAGAACTTGTGGCTCAATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-130s1c1
Sequence:CCGGGCATGGATCTTGCTCAGCAATCTCGAGATTGCTGAGCAAGATCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-1038s1c1
Sequence:CCGGCCCACTCTTCCTTCAGACTTACTCGAGTAAGTCTGAAGGAAGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-1185s1c1
Sequence:CCGGCCCACCGTGAAGAAGATTGATCTCGAGATCAATCTTCTTCACGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-810s1c1
Sequence:CCGGGAGGGCATTCAATCCCTGTATCTCGAGATACAGGGATTGAATGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019471
MMP10 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 10 (stromelysin 2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-1329s1c1
Sequence:CCGGCCAGGAATTGAGCCACAAGTTCTCGAGAACTTGTGGCTCAATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-130s1c1
Sequence:CCGGGCATGGATCTTGCTCAGCAATCTCGAGATTGCTGAGCAAGATCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-1038s1c1
Sequence:CCGGCCCACTCTTCCTTCAGACTTACTCGAGTAAGTCTGAAGGAAGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-1185s1c1
Sequence:CCGGCCCACCGTGAAGAAGATTGATCTCGAGATCAATCTTCTTCACGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-810s1c1
Sequence:CCGGGAGGGCATTCAATCCCTGTATCTCGAGATACAGGGATTGAATGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019471
MMP10 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 10 (stromelysin 2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-1329s1c1
Sequence:CCGGCCAGGAATTGAGCCACAAGTTCTCGAGAACTTGTGGCTCAATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-130s1c1
Sequence:CCGGGCATGGATCTTGCTCAGCAATCTCGAGATTGCTGAGCAAGATCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-1038s1c1
Sequence:CCGGCCCACTCTTCCTTCAGACTTACTCGAGTAAGTCTGAAGGAAGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-1185s1c1
Sequence:CCGGCCCACCGTGAAGAAGATTGATCTCGAGATCAATCTTCTTCACGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019471.1-810s1c1
Sequence:CCGGGAGGGCATTCAATCCCTGTATCTCGAGATACAGGGATTGAATGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)