EMAIL THIS PAGE TO A FRIEND

MMP11

matrix metallopeptidase 11 (stromelysin 3)

119 Gene Product Result for
Synonyms: SL-3 ST3 STMY3
UniProtKB ID: P24347, Q5FX24, Q6PEZ6, Q9UC26
Gene ID:
Human(4320) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the enzyme encoded by this gene is activated intracellularly by furin within the constitutive secretory pathway. Also in contrast to other MMP's, this enzyme cleaves alpha 1-proteinase inhibitor but weakly degrades structural proteins of the extracellular matrix. [provided by RefSeq, Jul 2008]
Mouse(17385) matrix metallopeptidase 11
Rat(25481) matrix metallopeptidase 11
sheep(101110364) matrix metallopeptidase 11 (stromelysin 3)
domestic guinea pig(100713229) matrix metallopeptidase 11 (stromelysin 3)
naked mole-rat(101699533) matrix metallopeptidase 11 (stromelysin 3)
chicken(769489) matrix metallopeptidase 11 (stromelysin 3)
dog(486408) matrix metallopeptidase 11 (stromelysin 3)
Horse(100056568) matrix metallopeptidase 11 (stromelysin 3)
cow(539109) matrix metallopeptidase 11 (stromelysin 3)
domestic cat(101089148) matrix metallopeptidase 11 (stromelysin 3)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M0431 Anti-Matrix Metalloproteinase-11, C-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
M9058 Anti-Matrix Metalloproteinase-11, Hinge Region antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
M0806 Anti-Matrix Metalloproteinase-11, N-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
M2556 Anti-Matrix Metalloproteinase-11, Propeptide Region antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4501898 Anti-MMP-11 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1300333 Anti-MMP11 (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, western blot pricing
GW21122 Anti-MMP11 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
HPA068864 Anti-MMP11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005940 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005940 Rosetta Predictions human pricing
NM_012980 Rosetta Predictions rat pricing
NM_008606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118566 predicted 1197
2 SASI_Hs01_00118567 predicted 1074
3 SASI_Hs01_00118568 predicted 1375
4 SASI_Hs01_00118569 predicted 428
5 SASI_Hs01_00118570 predicted 929
6 SASI_Hs01_00118571 predicted 1835
7 SASI_Hs01_00118572 predicted 1697
8 SASI_Hs01_00118573 predicted 445
9 SASI_Hs01_00118574 predicted 353
10 SASI_Hs01_00118575 predicted 1385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260592 predicted 851
2 SASI_Rn01_00072307 predicted 482
3 SASI_Rn02_00260593 predicted 1198
4 SASI_Rn01_00072308 predicted 727
5 SASI_Rn01_00072310 predicted 1100
6 SASI_Rn01_00072311 predicted 599
7 SASI_Rn01_00072313 predicted 1239
8 SASI_Rn02_00260594 predicted 1394
9 SASI_Rn01_00072315 predicted 353
10 SASI_Rn02_00260595 predicted 278
11 SASI_Rn01_00072306 predicted 1499
12 SASI_Rn01_00072309 predicted 654
13 SASI_Rn01_00072312 predicted 668
14 SASI_Rn01_00072314 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124872 predicted 1173
2 SASI_Mm01_00124873 predicted 346
3 SASI_Mm01_00124874 predicted 1091
4 SASI_Mm02_00314270 predicted 1205
5 SASI_Mm01_00124875 predicted 725
6 SASI_Mm01_00124878 predicted 1528
7 SASI_Mm01_00124879 predicted 293
8 SASI_Mm02_00314271 predicted 842
9 SASI_Mm01_00124880 predicted 1234
10 SASI_Mm01_00124881 predicted 638
11 SASI_Mm01_00124876 predicted 500
12 SASI_Mm01_00124877 predicted 1470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005940
MMP11 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 11 (stromelysin 3)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005940.3-849s21c1
Sequence:CCGGGGATAGACACCAATGAGATTGCTCGAGCAATCTCATTGGTGTCTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005940.3-1348s21c1
Sequence:CCGGTGCTGATGGCTATGCCTACTTCTCGAGAAGTAGGCATAGCCATCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-590s1c1
Sequence:CCGGGATGTCCACTTCGACTATGATCTCGAGATCATAGTCGAAGTGGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-724s1c1
Sequence:CCGGCGCCTTCTACACCTTTCGCTACTCGAGTAGCGAAAGGTGTAGAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-1204s1c1
Sequence:CCGGTCCCGAGAAGAACAAGATCTACTCGAGTAGATCTTGTTCTTCTCGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-1087s1c1
Sequence:CCGGGTTCTTCCAAGGTGCTCAGTACTCGAGTACTGAGCACCTTGGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-421s1c1
Sequence:CCGGCCTAAAGGTATGGAGCGATGTCTCGAGACATCGCTCCATACCTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005940
MMP11 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 11 (stromelysin 3)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005940.3-849s21c1
Sequence:CCGGGGATAGACACCAATGAGATTGCTCGAGCAATCTCATTGGTGTCTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005940.3-1348s21c1
Sequence:CCGGTGCTGATGGCTATGCCTACTTCTCGAGAAGTAGGCATAGCCATCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-590s1c1
Sequence:CCGGGATGTCCACTTCGACTATGATCTCGAGATCATAGTCGAAGTGGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-724s1c1
Sequence:CCGGCGCCTTCTACACCTTTCGCTACTCGAGTAGCGAAAGGTGTAGAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-1204s1c1
Sequence:CCGGTCCCGAGAAGAACAAGATCTACTCGAGTAGATCTTGTTCTTCTCGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-1087s1c1
Sequence:CCGGGTTCTTCCAAGGTGCTCAGTACTCGAGTACTGAGCACCTTGGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-421s1c1
Sequence:CCGGCCTAAAGGTATGGAGCGATGTCTCGAGACATCGCTCCATACCTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005940
MMP11 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 11 (stromelysin 3)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005940.3-849s21c1
Sequence:CCGGGGATAGACACCAATGAGATTGCTCGAGCAATCTCATTGGTGTCTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005940.3-1348s21c1
Sequence:CCGGTGCTGATGGCTATGCCTACTTCTCGAGAAGTAGGCATAGCCATCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-590s1c1
Sequence:CCGGGATGTCCACTTCGACTATGATCTCGAGATCATAGTCGAAGTGGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-724s1c1
Sequence:CCGGCGCCTTCTACACCTTTCGCTACTCGAGTAGCGAAAGGTGTAGAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-1204s1c1
Sequence:CCGGTCCCGAGAAGAACAAGATCTACTCGAGTAGATCTTGTTCTTCTCGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-1087s1c1
Sequence:CCGGGTTCTTCCAAGGTGCTCAGTACTCGAGTACTGAGCACCTTGGAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005940.2-421s1c1
Sequence:CCGGCCTAAAGGTATGGAGCGATGTCTCGAGACATCGCTCCATACCTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008606
VALIDATED
MMP11 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 11 (stromelysin 3)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-604s21c1
Sequence:CCGGCTATGATGAAACTTGGACTATCTCGAGATAGTCCAAGTTTCATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-272s21c1
Sequence:CCGGGACCTGCCTGATGTACTGAATCTCGAGATTCAGTACATCAGGCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-1387s21c1
Sequence:CCGGCTGGAAGTTTGATCCCGTGAACTCGAGTTCACGGGATCAAACTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-183s21c1
Sequence:CCGGCTCTGCCTAATACCTTGACATCTCGAGATGTCAAGGTATTAGGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008606.1-604s1c1
Sequence:CCGGCTATGATGAAACTTGGACTATCTCGAGATAGTCCAAGTTTCATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008606.1-1387s1c1
Sequence:CCGGCTGGAAGTTTGATCCCGTGAACTCGAGTTCACGGGATCAAACTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008606.1-272s1c1
Sequence:CCGGGACCTGCCTGATGTACTGAATCTCGAGATTCAGTACATCAGGCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008606.1-183s1c1
Sequence:CCGGCTCTGCCTAATACCTTGACATCTCGAGATGTCAAGGTATTAGGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008606
VALIDATED
MMP11 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 11 (stromelysin 3)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-604s21c1
Sequence:CCGGCTATGATGAAACTTGGACTATCTCGAGATAGTCCAAGTTTCATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-272s21c1
Sequence:CCGGGACCTGCCTGATGTACTGAATCTCGAGATTCAGTACATCAGGCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-1387s21c1
Sequence:CCGGCTGGAAGTTTGATCCCGTGAACTCGAGTTCACGGGATCAAACTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-183s21c1
Sequence:CCGGCTCTGCCTAATACCTTGACATCTCGAGATGTCAAGGTATTAGGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008606.1-604s1c1
Sequence:CCGGCTATGATGAAACTTGGACTATCTCGAGATAGTCCAAGTTTCATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008606.1-1387s1c1
Sequence:CCGGCTGGAAGTTTGATCCCGTGAACTCGAGTTCACGGGATCAAACTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008606.1-272s1c1
Sequence:CCGGGACCTGCCTGATGTACTGAATCTCGAGATTCAGTACATCAGGCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008606.1-183s1c1
Sequence:CCGGCTCTGCCTAATACCTTGACATCTCGAGATGTCAAGGTATTAGGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008606
VALIDATED
MMP11 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 11 (stromelysin 3)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-604s21c1
Sequence:CCGGCTATGATGAAACTTGGACTATCTCGAGATAGTCCAAGTTTCATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-272s21c1
Sequence:CCGGGACCTGCCTGATGTACTGAATCTCGAGATTCAGTACATCAGGCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-1387s21c1
Sequence:CCGGCTGGAAGTTTGATCCCGTGAACTCGAGTTCACGGGATCAAACTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008606.2-183s21c1
Sequence:CCGGCTCTGCCTAATACCTTGACATCTCGAGATGTCAAGGTATTAGGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008606.1-604s1c1
Sequence:CCGGCTATGATGAAACTTGGACTATCTCGAGATAGTCCAAGTTTCATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008606.1-1387s1c1
Sequence:CCGGCTGGAAGTTTGATCCCGTGAACTCGAGTTCACGGGATCAAACTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008606.1-272s1c1
Sequence:CCGGGACCTGCCTGATGTACTGAATCTCGAGATTCAGTACATCAGGCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008606.1-183s1c1
Sequence:CCGGCTCTGCCTAATACCTTGACATCTCGAGATGTCAAGGTATTAGGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)