EMAIL THIS PAGE TO A FRIEND

MMP12

matrix metallopeptidase 12 (macrophage elastase)

158 Gene Product Result for
Synonyms: HME ME MME MMP-12
UniProtKB ID: P39900, B2R9X8, B7ZLF6, Q2M1L9
Gene ID:
Human(4321) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. It is thought that the protein encoded by this gene is cleaved at both ends to yield the active enzyme, but this processing has not been fully described. The enzyme degrades soluble and insoluble elastin. It may play a role in aneurysm formation and studies in mice suggest a role in the development of emphysema. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008]
Mouse(17381) matrix metallopeptidase 12
Rat(117033) matrix metallopeptidase 12
domestic cat(101084472) matrix metallopeptidase 12 (macrophage elastase)
cow(526981) matrix metallopeptidase 12 (macrophage elastase)
dog(611789) matrix metallopeptidase 12 (macrophage elastase)
naked mole-rat(101716268) matrix metallopeptidase 12 (macrophage elastase)
Domestic Rabbit(100009559) matrix metallopeptidase 12 (macrophage elastase)
domestic guinea pig(100730930) matrix metallopeptidase 12 (macrophage elastase)
sheep(101119157) matrix metallopeptidase 12 (macrophage elastase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010651 MISSION® esiRNA esiRNA targeting human MMP12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002426 Rosetta Predictions human pricing
NM_053963 Rosetta Predictions rat pricing
NM_008605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077192 predicted 907
2 SASI_Hs01_00077193 predicted 695
3 SASI_Hs01_00077194 predicted 783
4 SASI_Hs01_00077195 predicted 365
5 SASI_Hs01_00077196 predicted 853
6 SASI_Hs01_00077197 predicted 644
7 SASI_Hs01_00077198 predicted 253
8 SASI_Hs01_00077199 predicted 450
9 SASI_Hs01_00077200 predicted 753
10 SASI_Hs01_00077201 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030151 predicted 904
2 SASI_Rn01_00030152 predicted 566
3 SASI_Rn01_00030153 predicted 665
4 SASI_Rn01_00030154 predicted 394
5 SASI_Rn01_00030155 predicted 380
6 SASI_Rn01_00030156 predicted 419
7 SASI_Rn01_00030158 predicted 1075
8 SASI_Rn01_00030159 predicted 766
9 SASI_Rn01_00030160 predicted 1023
10 SASI_Rn02_00266937 predicted 1176
11 SASI_Rn01_00030157 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051489 predicted 431
2 SASI_Mm01_00051490 predicted 1149
3 SASI_Mm01_00051491 predicted 499
4 SASI_Mm01_00051493 predicted 1529
5 SASI_Mm01_00051495 predicted 1099
6 SASI_Mm01_00051496 predicted 793
7 SASI_Mm01_00051497 predicted 1051
8 SASI_Mm01_00051498 predicted 1211
9 SASI_Mm02_00314268 predicted 893
10 SASI_Mm02_00314269 predicted 275
11 SASI_Mm01_00051492 predicted 246
12 SASI_Mm01_00051494 predicted 1134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002426
MMP12 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 12 (macrophage elastase)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002426.3-1645s21c1
Sequence:CCGGCTTGCTTGACTCTACTATTAACTCGAGTTAATAGTAGAGTCAAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002426.3-732s21c1
Sequence:CCGGTAGTGATCCAAAGGCCGTAATCTCGAGATTACGGCCTTTGGATCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-214s1c1
Sequence:CCGGCAGCACTTCTTGGGTCTGAAACTCGAGTTTCAGACCCAAGAAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-820s1c1
Sequence:CCGGCGCTTGCCAAATCCTGACAATCTCGAGATTGTCAGGATTTGGCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-1245s1c1
Sequence:CCGGCCCTGGTTATCCCAAACTGATCTCGAGATCAGTTTGGGATAACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-330s1c1
Sequence:CCGGGCCCGTATGGAGGAAACATTACTCGAGTAATGTTTCCTCCATACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002426.3-1333s21c1
Sequence:CCGGGATGCAGTCTTCTACTCTAAACTCGAGTTTAGAGTAGAAGACTGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002426
MMP12 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 12 (macrophage elastase)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002426.3-1645s21c1
Sequence:CCGGCTTGCTTGACTCTACTATTAACTCGAGTTAATAGTAGAGTCAAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002426.3-732s21c1
Sequence:CCGGTAGTGATCCAAAGGCCGTAATCTCGAGATTACGGCCTTTGGATCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-214s1c1
Sequence:CCGGCAGCACTTCTTGGGTCTGAAACTCGAGTTTCAGACCCAAGAAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-820s1c1
Sequence:CCGGCGCTTGCCAAATCCTGACAATCTCGAGATTGTCAGGATTTGGCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-1245s1c1
Sequence:CCGGCCCTGGTTATCCCAAACTGATCTCGAGATCAGTTTGGGATAACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-330s1c1
Sequence:CCGGGCCCGTATGGAGGAAACATTACTCGAGTAATGTTTCCTCCATACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002426.3-1333s21c1
Sequence:CCGGGATGCAGTCTTCTACTCTAAACTCGAGTTTAGAGTAGAAGACTGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002426
MMP12 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 12 (macrophage elastase)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002426.3-1645s21c1
Sequence:CCGGCTTGCTTGACTCTACTATTAACTCGAGTTAATAGTAGAGTCAAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002426.3-732s21c1
Sequence:CCGGTAGTGATCCAAAGGCCGTAATCTCGAGATTACGGCCTTTGGATCACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-214s1c1
Sequence:CCGGCAGCACTTCTTGGGTCTGAAACTCGAGTTTCAGACCCAAGAAGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-820s1c1
Sequence:CCGGCGCTTGCCAAATCCTGACAATCTCGAGATTGTCAGGATTTGGCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-1245s1c1
Sequence:CCGGCCCTGGTTATCCCAAACTGATCTCGAGATCAGTTTGGGATAACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002426.1-330s1c1
Sequence:CCGGGCCCGTATGGAGGAAACATTACTCGAGTAATGTTTCCTCCATACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002426.3-1333s21c1
Sequence:CCGGGATGCAGTCTTCTACTCTAAACTCGAGTTTAGAGTAGAAGACTGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008605
MMP12 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 12 (macrophage elastase)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-1168s1c1
Sequence:CCGGGATAAACACTACTGGAGGTATCTCGAGATACCTCCAGTAGTGTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-922s1c1
Sequence:CCGGGCCACCAACATTACTTCTATTCTCGAGAATAGAAGTAATGTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-318s1c1
Sequence:CCGGCCTCACTTACAGGATCTATAACTCGAGTTATAGATCCTGTAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-55s1c1
Sequence:CCGGCCCATGAATGACAGTGAATTTCTCGAGAAATTCACTGTCATTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-983s1c1
Sequence:CCGGCTTACGAAATTGAAAGCAGAACTCGAGTTCTGCTTTCAATTTCGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-1224s1c1
Sequence:CCGGCAAGCTGATTTCCACACACTTCTCGAGAAGTGTGTGGAAATCAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-657s1c1
Sequence:CCGGGCAGCATTCCAATAATCCAAACTCGAGTTTGGATTATTGGAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008605
MMP12 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 12 (macrophage elastase)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-1168s1c1
Sequence:CCGGGATAAACACTACTGGAGGTATCTCGAGATACCTCCAGTAGTGTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-922s1c1
Sequence:CCGGGCCACCAACATTACTTCTATTCTCGAGAATAGAAGTAATGTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-318s1c1
Sequence:CCGGCCTCACTTACAGGATCTATAACTCGAGTTATAGATCCTGTAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-55s1c1
Sequence:CCGGCCCATGAATGACAGTGAATTTCTCGAGAAATTCACTGTCATTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-983s1c1
Sequence:CCGGCTTACGAAATTGAAAGCAGAACTCGAGTTCTGCTTTCAATTTCGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-1224s1c1
Sequence:CCGGCAAGCTGATTTCCACACACTTCTCGAGAAGTGTGTGGAAATCAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-657s1c1
Sequence:CCGGGCAGCATTCCAATAATCCAAACTCGAGTTTGGATTATTGGAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008605
MMP12 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 12 (macrophage elastase)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-1168s1c1
Sequence:CCGGGATAAACACTACTGGAGGTATCTCGAGATACCTCCAGTAGTGTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-922s1c1
Sequence:CCGGGCCACCAACATTACTTCTATTCTCGAGAATAGAAGTAATGTTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-318s1c1
Sequence:CCGGCCTCACTTACAGGATCTATAACTCGAGTTATAGATCCTGTAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-55s1c1
Sequence:CCGGCCCATGAATGACAGTGAATTTCTCGAGAAATTCACTGTCATTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-983s1c1
Sequence:CCGGCTTACGAAATTGAAAGCAGAACTCGAGTTCTGCTTTCAATTTCGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-1224s1c1
Sequence:CCGGCAAGCTGATTTCCACACACTTCTCGAGAAGTGTGTGGAAATCAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008605.1-657s1c1
Sequence:CCGGGCAGCATTCCAATAATCCAAACTCGAGTTTGGATTATTGGAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)