EMAIL THIS PAGE TO A FRIEND

MMP13

matrix metallopeptidase 13 (collagenase 3)

82 Gene Product Result for
Synonyms: CLG3 MANDP1
UniProtKB ID: P45452
Gene ID:
Human(4322) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The protein encoded by this gene cleaves type II collagen more efficiently than types I and III. It may be involved in articular cartilage turnover and cartilage pathophysiology associated with osteoarthritis. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008]
Mouse(17386) matrix metallopeptidase 13
Rat(171052) matrix metallopeptidase 13
sheep(443113) matrix metallopeptidase 13 (collagenase 3)
domestic guinea pig(100731756) matrix metallopeptidase 13 (collagenase 3)
Domestic Rabbit(100008685) matrix metallopeptidase 13 (collagenase 3)
naked mole-rat(101699013) matrix metallopeptidase 13 (collagenase 3)
chicken(395683) matrix metallopeptidase 13 (collagenase 3)
domestic cat(493679) matrix metallopeptidase 13 (collagenase 3)
cow(281914) matrix metallopeptidase 13 (collagenase 3)
Horse(100009711) matrix metallopeptidase 13 (collagenase 3)
dog(403763) matrix metallopeptidase 13 (collagenase 3)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002427 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067151 MISSION® esiRNA esiRNA human MMP13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002427 Rosetta Predictions human pricing
XM_001072242 Rosetta Predictions rat pricing
XM_343345 Rosetta Predictions rat pricing
NM_008607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089189 predicted 410
2 SASI_Hs01_00089190 predicted 273
3 SASI_Hs01_00089191 predicted 482
4 SASI_Hs01_00089192 predicted 1016
5 SASI_Hs01_00089193 predicted 446
6 SASI_Hs02_00333823 predicted 1159
7 SASI_Hs01_00089194 predicted 1134
8 SASI_Hs01_00089195 predicted 249
9 SASI_Hs01_00089196 predicted 320
10 SASI_Hs01_00089197 predicted 1299
11 SASI_Hs01_00089198 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338371 predicted 1431
2 SASI_Rn02_00338372 predicted 1540
3 SASI_Rn02_00338373 predicted 318
4 SASI_Rn02_00338374 predicted 1418
5 SASI_Rn02_00338375 predicted 743
6 SASI_Rn02_00338376 predicted 913
7 SASI_Rn02_00338377 predicted 1435
8 SASI_Rn02_00338378 predicted 1398
9 SASI_Rn02_00338379 predicted 403
10 SASI_Rn02_00338380 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395663 predicted 1615
2 SASI_Rn02_00395664 predicted 1427
3 SASI_Rn02_00395665 predicted 1542
4 SASI_Rn02_00395666 predicted 1414
5 SASI_Rn02_00395667 predicted 1471
6 SASI_Rn02_00395668 predicted 1311
7 SASI_Rn02_00395669 predicted 1430
8 SASI_Rn02_00395670 predicted 1362
9 SASI_Rn02_00395671 predicted 1400
10 SASI_Rn02_00395672 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314272 predicted 1411
2 SASI_Mm02_00314273 predicted 264
3 SASI_Mm02_00314274 predicted 465
4 SASI_Mm02_00314275 predicted 649
5 SASI_Mm02_00314276 predicted 1413
6 SASI_Mm02_00314277 predicted 355
7 SASI_Mm02_00314278 predicted 367
8 SASI_Mm02_00314279 predicted 492
9 SASI_Mm02_00314280 predicted 1216
10 SASI_Mm02_00314281 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002427
MMP13 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 13 (collagenase 3)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002427.2-161s21c1
Sequence:CCGGTCATACTACCATCCTACAAATCTCGAGATTTGTAGGATGGTAGTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002427.2-1732s21c1
Sequence:CCGGCTGTCAATGAGAGCATAATTTCTCGAGAAATTATGCTCTCATTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002427.2-1267s21c1
Sequence:CCGGTAAAGACTATCCGAGACTAATCTCGAGATTAGTCTCGGATAGTCTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-465s1c1
Sequence:CCGGCCGATGTAACTCCTCTGAATTCTCGAGAATTCAGAGGAGTTACATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-916s1c1
Sequence:CCGGCCGAGGAGAAACAATGATCTTCTCGAGAAGATCATTGTTTCTCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-353s1c1
Sequence:CCGGCGAACTCTTAAATGGTCCAAACTCGAGTTTGGACCATTTAAGAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-229s1c1
Sequence:CCGGGCTCCGAGAAATGCAGTCTTTCTCGAGAAAGACTGCATTTCTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-1020s1c1
Sequence:CCGGCCAACCGTATTGATGCTGCATCTCGAGATGCAGCATCAATACGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002427
MMP13 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 13 (collagenase 3)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002427.2-161s21c1
Sequence:CCGGTCATACTACCATCCTACAAATCTCGAGATTTGTAGGATGGTAGTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002427.2-1732s21c1
Sequence:CCGGCTGTCAATGAGAGCATAATTTCTCGAGAAATTATGCTCTCATTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002427.2-1267s21c1
Sequence:CCGGTAAAGACTATCCGAGACTAATCTCGAGATTAGTCTCGGATAGTCTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-465s1c1
Sequence:CCGGCCGATGTAACTCCTCTGAATTCTCGAGAATTCAGAGGAGTTACATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-916s1c1
Sequence:CCGGCCGAGGAGAAACAATGATCTTCTCGAGAAGATCATTGTTTCTCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-353s1c1
Sequence:CCGGCGAACTCTTAAATGGTCCAAACTCGAGTTTGGACCATTTAAGAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-229s1c1
Sequence:CCGGGCTCCGAGAAATGCAGTCTTTCTCGAGAAAGACTGCATTTCTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-1020s1c1
Sequence:CCGGCCAACCGTATTGATGCTGCATCTCGAGATGCAGCATCAATACGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002427
MMP13 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 13 (collagenase 3)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002427.2-161s21c1
Sequence:CCGGTCATACTACCATCCTACAAATCTCGAGATTTGTAGGATGGTAGTATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002427.2-1732s21c1
Sequence:CCGGCTGTCAATGAGAGCATAATTTCTCGAGAAATTATGCTCTCATTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002427.2-1267s21c1
Sequence:CCGGTAAAGACTATCCGAGACTAATCTCGAGATTAGTCTCGGATAGTCTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-465s1c1
Sequence:CCGGCCGATGTAACTCCTCTGAATTCTCGAGAATTCAGAGGAGTTACATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-916s1c1
Sequence:CCGGCCGAGGAGAAACAATGATCTTCTCGAGAAGATCATTGTTTCTCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-353s1c1
Sequence:CCGGCGAACTCTTAAATGGTCCAAACTCGAGTTTGGACCATTTAAGAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-229s1c1
Sequence:CCGGGCTCCGAGAAATGCAGTCTTTCTCGAGAAAGACTGCATTTCTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002427.2-1020s1c1
Sequence:CCGGCCAACCGTATTGATGCTGCATCTCGAGATGCAGCATCAATACGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008607
MMP13 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 13 (collagenase 3)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-133s21c1
Sequence:CCGGGCACTACTTGAAATCATACTACTCGAGTAGTATGATTTCAAGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008607.1-2043s21c1
Sequence:CCGGGCCTTACATTTGGCTTAATTTCTCGAGAAATTAAGCCAAATGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-1039s21c1
Sequence:CCGGCCGTGACCTTATGTTTATCTTCTCGAGAAGATAAACATAAGGTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-214s21c1
Sequence:CCGGGCTCCGAGAAATGCAATCTTTCTCGAGAAAGATTGCATTTCTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-725s21c1
Sequence:CCGGGCCCTGATGTTTCCCATCTATCTCGAGATAGATGGGAAACATCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008607.1-2043s1c1
Sequence:CCGGGCCTTACATTTGGCTTAATTTCTCGAGAAATTAAGCCAAATGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-133s1c1
Sequence:CCGGGCACTACTTGAAATCATACTACTCGAGTAGTATGATTTCAAGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-214s1c1
Sequence:CCGGGCTCCGAGAAATGCAATCTTTCTCGAGAAAGATTGCATTTCTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-1039s1c1
Sequence:CCGGCCGTGACCTTATGTTTATCTTCTCGAGAAGATAAACATAAGGTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-725s1c1
Sequence:CCGGGCCCTGATGTTTCCCATCTATCTCGAGATAGATGGGAAACATCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008607
MMP13 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 13 (collagenase 3)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-133s21c1
Sequence:CCGGGCACTACTTGAAATCATACTACTCGAGTAGTATGATTTCAAGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008607.1-2043s21c1
Sequence:CCGGGCCTTACATTTGGCTTAATTTCTCGAGAAATTAAGCCAAATGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-1039s21c1
Sequence:CCGGCCGTGACCTTATGTTTATCTTCTCGAGAAGATAAACATAAGGTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-214s21c1
Sequence:CCGGGCTCCGAGAAATGCAATCTTTCTCGAGAAAGATTGCATTTCTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-725s21c1
Sequence:CCGGGCCCTGATGTTTCCCATCTATCTCGAGATAGATGGGAAACATCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008607.1-2043s1c1
Sequence:CCGGGCCTTACATTTGGCTTAATTTCTCGAGAAATTAAGCCAAATGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-133s1c1
Sequence:CCGGGCACTACTTGAAATCATACTACTCGAGTAGTATGATTTCAAGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-214s1c1
Sequence:CCGGGCTCCGAGAAATGCAATCTTTCTCGAGAAAGATTGCATTTCTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-1039s1c1
Sequence:CCGGCCGTGACCTTATGTTTATCTTCTCGAGAAGATAAACATAAGGTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-725s1c1
Sequence:CCGGGCCCTGATGTTTCCCATCTATCTCGAGATAGATGGGAAACATCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008607
MMP13 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 13 (collagenase 3)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-133s21c1
Sequence:CCGGGCACTACTTGAAATCATACTACTCGAGTAGTATGATTTCAAGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008607.1-2043s21c1
Sequence:CCGGGCCTTACATTTGGCTTAATTTCTCGAGAAATTAAGCCAAATGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-1039s21c1
Sequence:CCGGCCGTGACCTTATGTTTATCTTCTCGAGAAGATAAACATAAGGTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-214s21c1
Sequence:CCGGGCTCCGAGAAATGCAATCTTTCTCGAGAAAGATTGCATTTCTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008607.1-725s21c1
Sequence:CCGGGCCCTGATGTTTCCCATCTATCTCGAGATAGATGGGAAACATCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031259    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008607.1-2043s1c1
Sequence:CCGGGCCTTACATTTGGCTTAATTTCTCGAGAAATTAAGCCAAATGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-133s1c1
Sequence:CCGGGCACTACTTGAAATCATACTACTCGAGTAGTATGATTTCAAGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-214s1c1
Sequence:CCGGGCTCCGAGAAATGCAATCTTTCTCGAGAAAGATTGCATTTCTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-1039s1c1
Sequence:CCGGCCGTGACCTTATGTTTATCTTCTCGAGAAGATAAACATAAGGTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008607.1-725s1c1
Sequence:CCGGGCCCTGATGTTTCCCATCTATCTCGAGATAGATGGGAAACATCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)