EMAIL THIS PAGE TO A FRIEND

MMP14

matrix metallopeptidase 14 (membrane-inserted)

128 Gene Product Result for
Synonyms: MMP-14 MMP-X1 MT-MMP MT-MMP 1 MT1-MMP MT1MMP MTMMP1
UniProtKB ID: P50281, A8K5L0, Q6GSF3, Q92678
Gene ID:
Human(4323) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the protein encoded by this gene is a member of the membrane-type MMP (MT-MMP) subfamily; each member of this subfamily contains a potential transmembrane domain suggesting that these proteins are expressed at the cell surface rather than secreted. This protein activates MMP2 protein, and this activity may be involved in tumor invasion. [provided by RefSeq, Jul 2008]
Mouse(17387) matrix metallopeptidase 14 (membrane-inserted)
Rat(81707) matrix metallopeptidase 14 (membrane-inserted)
chicken(426253) matrix metallopeptidase 14 (membrane-inserted)
cow(281915) matrix metallopeptidase 14 (membrane-inserted)
Horse(100034170) matrix metallopeptidase 14 (membrane-inserted)
domestic cat(101089776) matrix metallopeptidase 14 (membrane-inserted)
dog(403823) matrix metallopeptidase 14 (membrane-inserted)
naked mole-rat(101723795) matrix metallopeptidase 14 (membrane-inserted)
Domestic Rabbit(100009598) matrix metallopeptidase 14 (membrane-inserted)
domestic guinea pig(100732039) matrix metallopeptidase 14 (membrane-inserted)
sheep(443116) matrix metallopeptidase 14 (membrane-inserted)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004995 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004995 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004995 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
MAB1767 Anti-Human MT1-MMP catalytic domain Antibody, clone 3G4.2 Detect Human MT1-MMP catalytic domain using this Anti-Human MT1-MMP catalytic domain Antibody, clone 3G4.2 validated for use in WB, IC, IH. pricing
AB8221 Anti-MMP-14 Antibody Anti-MMP-14 Antibody is an antibody against MMP-14 for use in WB. pricing
AB8345 Anti-MMP-14 Antibody Anti-MMP-14 Antibody detects level of MMP-14 & has been published & validated for use in ELISA, FC, IP, WB & IC. pricing
MAB3319 Anti-MMP-14 Antibody, catalytic domain, clone 114-6G6 This Anti-MMP-14 Antibody, catalytic domain, clone 114-6G6 is validated for use in ELISA, WB, IH(P) for the detection of MMP-14. pricing
MAB3328 Anti-MMP-14 Antibody, catalytic domain, clone LEM-2/15.8 Detect MMP-14 using this Anti-MMP-14 Antibody, catalytic domain, clone LEM-2/15.8 validated for use in ELISA, IP & WB. pricing
MAB3329 Anti-MMP-14 Antibody, catalytic domain, clone LEM-2/63.1 Anti-MMP-14 Antibody, catalytic domain, clone LEM-2/63.1 detects level of MMP-14 & has been published & validated for use in ELISA, IP & WB. pricing
MAB3317 Anti-MMP-14 Antibody, hemopexin domain, clone 113-5B7 Anti-MMP-14 Antibody, hemopexin domain, clone 113-5B7 is an antibody against MMP-14 for use in ELISA, IH(P) & WB. pricing
AB6005 Anti-MT1-MMP Antibody, catalytic domain Anti-MT1-MMP Antibody, catalytic domain is an antibody against MT1-MMP for use in WB, IC, IH & IP. pricing
AB6070 Anti-MT1-MMP Antibody, hemopexin domain This Anti-MT1-MMP Antibody, hemopexin domain is validated for use in WB, IH(P) for the detection of MT1-MMP. pricing
CC1043 MMP-14, human, prodomain, catalytic domain, and hemopexin domain, E. coli recombinant pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004995 Rosetta Predictions human pricing
NM_031056 Rosetta Predictions rat pricing
NM_008608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050592 predicted 575
2 SASI_Hs01_00050594 predicted 1388
3 SASI_Hs01_00050595 predicted 1355
4 SASI_Hs01_00050596 predicted 1362
5 SASI_Hs01_00050597 predicted 1526
6 SASI_Hs01_00050598 predicted 1280
7 SASI_Hs01_00050599 predicted 1363
8 SASI_Hs01_00050600 predicted 1622
9 SASI_Hs01_00050601 predicted 649
10 SASI_Hs02_00338728 predicted 1623
11 SASI_Hs01_00050593 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045934 predicted 690
2 SASI_Rn01_00045936 predicted 364
3 SASI_Rn01_00045937 predicted 1585
4 SASI_Rn01_00045938 predicted 1866
5 SASI_Rn01_00045939 predicted 1313
6 SASI_Rn02_00264289 predicted 1477
7 SASI_Rn01_00045940 predicted 1589
8 SASI_Rn01_00045941 predicted 442
9 SASI_Rn02_00264290 predicted 1600
10 SASI_Rn02_00264291 predicted 532
11 SASI_Rn01_00045935 predicted 1160
12 SASI_Rn01_00045942 predicted 583
13 SASI_Rn01_00045943 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150275 predicted 1556
2 SASI_Mm02_00314282 predicted 1385
3 SASI_Mm01_00150276 predicted 1683
4 SASI_Mm02_00314283 predicted 794
5 SASI_Mm01_00150277 predicted 545
6 SASI_Mm01_00150279 predicted 1683
7 SASI_Mm01_00150280 predicted 1309
8 SASI_Mm01_00150281 predicted 1653
9 SASI_Mm01_00150283 predicted 1408
10 SASI_Mm01_00150284 predicted 1387
11 SASI_Mm01_00150278 predicted 2042
12 SASI_Mm01_00150282 predicted 621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008608
MMP14 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 14 (membrane-inserted)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000031264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-1346s1c1
Sequence:CCGGCCATCAATACTGCCTACGAAACTCGAGTTTCGTAGGCAGTATTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-533s1c1
Sequence:CCGGCGGATAAGTTTGGGACTGAGACTCGAGTCTCAGTCCCAAACTTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-1652s1c1
Sequence:CCGGGCAGTGATGAAGTCTTCACATCTCGAGATGTGAAGACTTCATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-1083s1c1
Sequence:CCGGCCAGCAACTTTATGGAAGCAACTCGAGTTGCTTCCATAAAGTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008608
MMP14 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 14 (membrane-inserted)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000031264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-1346s1c1
Sequence:CCGGCCATCAATACTGCCTACGAAACTCGAGTTTCGTAGGCAGTATTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-533s1c1
Sequence:CCGGCGGATAAGTTTGGGACTGAGACTCGAGTCTCAGTCCCAAACTTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-1652s1c1
Sequence:CCGGGCAGTGATGAAGTCTTCACATCTCGAGATGTGAAGACTTCATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-1083s1c1
Sequence:CCGGCCAGCAACTTTATGGAAGCAACTCGAGTTGCTTCCATAAAGTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008608
MMP14 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 14 (membrane-inserted)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000031264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-1346s1c1
Sequence:CCGGCCATCAATACTGCCTACGAAACTCGAGTTTCGTAGGCAGTATTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-533s1c1
Sequence:CCGGCGGATAAGTTTGGGACTGAGACTCGAGTCTCAGTCCCAAACTTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-1652s1c1
Sequence:CCGGGCAGTGATGAAGTCTTCACATCTCGAGATGTGAAGACTTCATCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008608.2-1083s1c1
Sequence:CCGGCCAGCAACTTTATGGAAGCAACTCGAGTTGCTTCCATAAAGTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004995
MMP14 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 14 (membrane-inserted)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-1644s1c1
Sequence:CCGGCGATGAAGTCTTCACTTACTTCTCGAGAAGTAAGTGAAGACTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-535s1c1
Sequence:CCGGGCTGAGATCAAGGCCAATGTTCTCGAGAACATTGGCCTTGATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-1020s1c1
Sequence:CCGGGTGGATGGACACGGAGAATTTCTCGAGAAATTCTCCGTGTCCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-348s1c1
Sequence:CCGGGCTACAGCAATATGGCTACCTCTCGAGAGGTAGCCATATTGCTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-1138s1c1
Sequence:CCGGCGGCCTTCTGTTCCTGATAAACTCGAGTTTATCAGGAACAGAAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004995.2-2165s21c1
Sequence:CCGGCATTGCATCTTCCCTAGATAGCTCGAGCTATCTAGGGAAGATGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004995.2-512s21c1
Sequence:CCGGGTGGTGTTCCAGACAAGTTTGCTCGAGCAAACTTGTCTGGAACACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004995
MMP14 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 14 (membrane-inserted)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-1644s1c1
Sequence:CCGGCGATGAAGTCTTCACTTACTTCTCGAGAAGTAAGTGAAGACTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-535s1c1
Sequence:CCGGGCTGAGATCAAGGCCAATGTTCTCGAGAACATTGGCCTTGATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-1020s1c1
Sequence:CCGGGTGGATGGACACGGAGAATTTCTCGAGAAATTCTCCGTGTCCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-348s1c1
Sequence:CCGGGCTACAGCAATATGGCTACCTCTCGAGAGGTAGCCATATTGCTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-1138s1c1
Sequence:CCGGCGGCCTTCTGTTCCTGATAAACTCGAGTTTATCAGGAACAGAAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004995.2-2165s21c1
Sequence:CCGGCATTGCATCTTCCCTAGATAGCTCGAGCTATCTAGGGAAGATGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004995.2-512s21c1
Sequence:CCGGGTGGTGTTCCAGACAAGTTTGCTCGAGCAAACTTGTCTGGAACACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004995
MMP14 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 14 (membrane-inserted)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-1644s1c1
Sequence:CCGGCGATGAAGTCTTCACTTACTTCTCGAGAAGTAAGTGAAGACTTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-535s1c1
Sequence:CCGGGCTGAGATCAAGGCCAATGTTCTCGAGAACATTGGCCTTGATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-1020s1c1
Sequence:CCGGGTGGATGGACACGGAGAATTTCTCGAGAAATTCTCCGTGTCCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-348s1c1
Sequence:CCGGGCTACAGCAATATGGCTACCTCTCGAGAGGTAGCCATATTGCTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004995.2-1138s1c1
Sequence:CCGGCGGCCTTCTGTTCCTGATAAACTCGAGTTTATCAGGAACAGAAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004995.2-2165s21c1
Sequence:CCGGCATTGCATCTTCCCTAGATAGCTCGAGCTATCTAGGGAAGATGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004995.2-512s21c1
Sequence:CCGGGTGGTGTTCCAGACAAGTTTGCTCGAGCAAACTTGTCTGGAACACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)