EMAIL THIS PAGE TO A FRIEND

MMP15

matrix metallopeptidase 15 (membrane-inserted)

58 Gene Product Result for
Synonyms: MT2-MMP MTMMP2 SMCP-2
UniProtKB ID: P51511, A0A2U6, Q14111
Gene ID:
Human(4324) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the protein encoded by this gene is a member of the membrane-type MMP (MT-MMP) subfamily; each member of this subfamily contains a potential transmembrane domain suggesting that these proteins are expressed at the cell surface rather than secreted. [provided by RefSeq, Jul 2008]
Mouse(17388) matrix metallopeptidase 15
Rat(291848) matrix metallopeptidase 15
chicken(415629) matrix metallopeptidase 15 (membrane-inserted)
domestic cat(101088040) matrix metallopeptidase 15 (membrane-inserted)
cow(282887) matrix metallopeptidase 15 (membrane-inserted)
Horse(100062872) matrix metallopeptidase 15 (membrane-inserted)
dog(487257) matrix metallopeptidase 15 (membrane-inserted)
sheep(101122213) matrix metallopeptidase 15 (membrane-inserted)
domestic guinea pig(100720154) matrix metallopeptidase 15 (membrane-inserted)
Domestic Rabbit(100347975) matrix metallopeptidase 15 (membrane-inserted)
naked mole-rat(101718286) matrix metallopeptidase 15 (membrane-inserted)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002428 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002428 Rosetta Predictions human pricing
NM_001106168 Rosetta Predictions rat pricing
NM_008609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173256 predicted 2417
2 SASI_Hs01_00173257 predicted 1620
3 SASI_Hs01_00173258 predicted 1812
4 SASI_Hs02_00333824 predicted 1614
5 SASI_Hs01_00173259 predicted 2373
6 SASI_Hs01_00173261 predicted 1228
7 SASI_Hs02_00333825 predicted 3342
8 SASI_Hs01_00173262 predicted 1386
9 SASI_Hs01_00173263 predicted 3343
10 SASI_Hs01_00173265 predicted 1543
11 SASI_Hs01_00173260 predicted 1679
12 SASI_Hs01_00173264 predicted 2376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216298 predicted 657
2 SASI_Rn02_00216299 predicted 684
3 SASI_Rn02_00216300 predicted 1182
4 SASI_Rn02_00216301 predicted 793
5 SASI_Rn02_00216302 predicted 1994
6 SASI_Rn02_00216303 predicted 791
7 SASI_Rn02_00216304 predicted 677
8 SASI_Rn02_00216305 predicted 947
9 SASI_Rn02_00216306 predicted 728
10 SASI_Rn02_00216307 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201727 predicted 2079
2 SASI_Mm01_00201728 predicted 1244
3 SASI_Mm01_00201729 predicted 903
4 SASI_Mm01_00201730 predicted 1941
5 SASI_Mm01_00201731 predicted 970
6 SASI_Mm01_00201732 predicted 764
7 SASI_Mm01_00201733 predicted 1032
8 SASI_Mm01_00201734 predicted 675
9 SASI_Mm01_00201735 predicted 1909
10 SASI_Mm01_00201736 predicted 2462
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008609
MMP15 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 15 (membrane-inserted)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008609.3-1316s21c1
Sequence:CCGGGGGCTAGAACACTCAAGTAACCTCGAGGTTACTTGAGTGTTCTAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008609.3-2917s21c1
Sequence:CCGGTTGCCTTAGGGAGAGTATATGCTCGAGCATATACTCTCCCTAAGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008609.2-2639s1c1
Sequence:CCGGGCAGCTTCTTTCCTCTAGGAACTCGAGTTCCTAGAGGAAAGAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008609.2-912s1c1
Sequence:CCGGCGCTATTATGGCACCCTTCTACTCGAGTAGAAGGGTGCCATAATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008609.2-1512s1c1
Sequence:CCGGCACAGGTCACACCTTCTTCTTCTCGAGAAGAAGAAGGTGTGACCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008609.2-936s1c1
Sequence:CCGGGTGGATGGATACCGACAACTTCTCGAGAAGTTGTCGGTATCCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008609.3-638s21c1
Sequence:CCGGGGCCATGGTACAGCGTCTAAACTCGAGTTTAGACGCTGTACCATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008609
MMP15 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 15 (membrane-inserted)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008609.3-1316s21c1
Sequence:CCGGGGGCTAGAACACTCAAGTAACCTCGAGGTTACTTGAGTGTTCTAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008609.3-2917s21c1
Sequence:CCGGTTGCCTTAGGGAGAGTATATGCTCGAGCATATACTCTCCCTAAGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008609.2-2639s1c1
Sequence:CCGGGCAGCTTCTTTCCTCTAGGAACTCGAGTTCCTAGAGGAAAGAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008609.2-912s1c1
Sequence:CCGGCGCTATTATGGCACCCTTCTACTCGAGTAGAAGGGTGCCATAATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008609.2-1512s1c1
Sequence:CCGGCACAGGTCACACCTTCTTCTTCTCGAGAAGAAGAAGGTGTGACCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008609.2-936s1c1
Sequence:CCGGGTGGATGGATACCGACAACTTCTCGAGAAGTTGTCGGTATCCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008609.3-638s21c1
Sequence:CCGGGGCCATGGTACAGCGTCTAAACTCGAGTTTAGACGCTGTACCATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008609
MMP15 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 15 (membrane-inserted)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008609.3-1316s21c1
Sequence:CCGGGGGCTAGAACACTCAAGTAACCTCGAGGTTACTTGAGTGTTCTAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008609.3-2917s21c1
Sequence:CCGGTTGCCTTAGGGAGAGTATATGCTCGAGCATATACTCTCCCTAAGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031269    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008609.2-2639s1c1
Sequence:CCGGGCAGCTTCTTTCCTCTAGGAACTCGAGTTCCTAGAGGAAAGAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008609.2-912s1c1
Sequence:CCGGCGCTATTATGGCACCCTTCTACTCGAGTAGAAGGGTGCCATAATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008609.2-1512s1c1
Sequence:CCGGCACAGGTCACACCTTCTTCTTCTCGAGAAGAAGAAGGTGTGACCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008609.2-936s1c1
Sequence:CCGGGTGGATGGATACCGACAACTTCTCGAGAAGTTGTCGGTATCCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008609.3-638s21c1
Sequence:CCGGGGCCATGGTACAGCGTCTAAACTCGAGTTTAGACGCTGTACCATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002428
VALIDATED
MMP15 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 15 (membrane-inserted)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002428.2-1402s1c1
Sequence:CCGGTCTGACCTTTAGCATCCAGAACTCGAGTTCTGGATGCTAAAGGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002428.2-3147s21c1
Sequence:CCGGGGCACCTTACTTGACCATTTGCTCGAGCAAATGGTCAAGTAAGGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002428.2-1816s21c1
Sequence:CCGGCCAGTGGAAGGACGTTGACAACTCGAGTTGTCAACGTCCTTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002428.2-2221s1c1
Sequence:CCGGCGGTGACATCAGTGCTGCCTACTCGAGTAGGCAGCACTGATGTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002428.2-1556s1c1
Sequence:CCGGGCCGACATCATGGTACTCTTTCTCGAGAAAGAGTACCATGATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002428.2-2527s1c1
Sequence:CCGGCCTGAGCAATGACGCAGCCTACTCGAGTAGGCTGCGTCATTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002428.2-1816s1c1
Sequence:CCGGCCAGTGGAAGGACGTTGACAACTCGAGTTGTCAACGTCCTTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002428.2-1625s21c1
Sequence:CCGGTTTCTGGCCCACGCCTATTTCCTCGAGGAAATAGGCGTGGGCCAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002428.2-1556s21c1
Sequence:CCGGGCCGACATCATGGTACTCTTTCTCGAGAAAGAGTACCATGATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002428.2-2527s21c1
Sequence:CCGGCCTGAGCAATGACGCAGCCTACTCGAGTAGGCTGCGTCATTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002428
VALIDATED
MMP15 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 15 (membrane-inserted)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002428.2-1402s1c1
Sequence:CCGGTCTGACCTTTAGCATCCAGAACTCGAGTTCTGGATGCTAAAGGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002428.2-3147s21c1
Sequence:CCGGGGCACCTTACTTGACCATTTGCTCGAGCAAATGGTCAAGTAAGGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002428.2-1816s21c1
Sequence:CCGGCCAGTGGAAGGACGTTGACAACTCGAGTTGTCAACGTCCTTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002428.2-2221s1c1
Sequence:CCGGCGGTGACATCAGTGCTGCCTACTCGAGTAGGCAGCACTGATGTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002428.2-1556s1c1
Sequence:CCGGGCCGACATCATGGTACTCTTTCTCGAGAAAGAGTACCATGATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002428.2-2527s1c1
Sequence:CCGGCCTGAGCAATGACGCAGCCTACTCGAGTAGGCTGCGTCATTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002428.2-1816s1c1
Sequence:CCGGCCAGTGGAAGGACGTTGACAACTCGAGTTGTCAACGTCCTTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002428.2-1625s21c1
Sequence:CCGGTTTCTGGCCCACGCCTATTTCCTCGAGGAAATAGGCGTGGGCCAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002428.2-1556s21c1
Sequence:CCGGGCCGACATCATGGTACTCTTTCTCGAGAAAGAGTACCATGATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002428.2-2527s21c1
Sequence:CCGGCCTGAGCAATGACGCAGCCTACTCGAGTAGGCTGCGTCATTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002428
VALIDATED
MMP15 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 15 (membrane-inserted)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002428.2-1402s1c1
Sequence:CCGGTCTGACCTTTAGCATCCAGAACTCGAGTTCTGGATGCTAAAGGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307291    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002428.2-3147s21c1
Sequence:CCGGGGCACCTTACTTGACCATTTGCTCGAGCAAATGGTCAAGTAAGGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002428.2-1816s21c1
Sequence:CCGGCCAGTGGAAGGACGTTGACAACTCGAGTTGTCAACGTCCTTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002428.2-2221s1c1
Sequence:CCGGCGGTGACATCAGTGCTGCCTACTCGAGTAGGCAGCACTGATGTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002428.2-1556s1c1
Sequence:CCGGGCCGACATCATGGTACTCTTTCTCGAGAAAGAGTACCATGATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002428.2-2527s1c1
Sequence:CCGGCCTGAGCAATGACGCAGCCTACTCGAGTAGGCTGCGTCATTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002428.2-1816s1c1
Sequence:CCGGCCAGTGGAAGGACGTTGACAACTCGAGTTGTCAACGTCCTTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002428.2-1625s21c1
Sequence:CCGGTTTCTGGCCCACGCCTATTTCCTCGAGGAAATAGGCGTGGGCCAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002428.2-1556s21c1
Sequence:CCGGGCCGACATCATGGTACTCTTTCTCGAGAAAGAGTACCATGATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002428.2-2527s21c1
Sequence:CCGGCCTGAGCAATGACGCAGCCTACTCGAGTAGGCTGCGTCATTGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)