EMAIL THIS PAGE TO A FRIEND

MMP16

matrix metallopeptidase 16 (membrane-inserted)

293 Gene Product Result for
Synonyms: C8orf57 MMP-X2 MT-MMP2 MT-MMP3 MT3-MMP
UniProtKB ID: P51512, B2RAN7, Q14824, Q52H48
Gene ID:
Human(4325) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The encoded protein activates MMP2 by cleavage. This gene was once referred to as MT-MMP2, but was renamed as MT-MMP3 or MMP16. [provided by RefSeq, Oct 2010]
Mouse(17389) matrix metallopeptidase 16
Rat(65205) matrix metallopeptidase 16
chicken(396116) matrix metallopeptidase 16 (membrane-inserted)
domestic cat(493663) matrix metallopeptidase 16 (membrane-inserted)
cow(282886) matrix metallopeptidase 16 (membrane-inserted)
Horse(100049862) matrix metallopeptidase 16 (membrane-inserted)
dog(487036) matrix metallopeptidase 16 (membrane-inserted)
naked mole-rat(101711864) matrix metallopeptidase 16 (membrane-inserted)
domestic guinea pig(100713166) matrix metallopeptidase 16 (membrane-inserted)
sheep(101116410) matrix metallopeptidase 16 (membrane-inserted)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005941 Rosetta Predictions human pricing
NM_022564 Rosetta Predictions human pricing
NM_080776 Rosetta Predictions rat pricing
NM_019724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044150 predicted 977
2 SASI_Hs01_00044151 predicted 1280
3 SASI_Hs01_00044152 predicted 943
4 SASI_Hs01_00044153 predicted 807
5 SASI_Hs01_00044154 predicted 819
6 SASI_Hs01_00044155 predicted 1079
7 SASI_Hs01_00044156 predicted 1121
8 SASI_Hs01_00044157 predicted 777
9 SASI_Hs01_00044158 predicted 590
10 SASI_Hs01_00044159 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097488 predicted 1272
2 SASI_Hs01_00097489 predicted 807
3 SASI_Hs01_00097490 predicted 1018
4 SASI_Hs02_00355857 predicted 1055
5 SASI_Hs01_00097491 predicted 736
6 SASI_Hs01_00097492 predicted 945
7 SASI_Hs01_00097493 predicted 810
8 SASI_Hs01_00097494 predicted 816
9 SASI_Hs01_00097495 predicted 740
10 SASI_Hs01_00097496 predicted 1124
11 SASI_Hs01_00097497 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056894 predicted 836
2 SASI_Rn01_00056895 predicted 772
3 SASI_Rn01_00056896 predicted 1065
4 SASI_Rn01_00056897 predicted 1596
5 SASI_Rn01_00056898 predicted 959
6 SASI_Rn01_00056899 predicted 816
7 SASI_Rn01_00056900 predicted 1698
8 SASI_Rn01_00056901 predicted 1972
9 SASI_Rn01_00056902 predicted 1797
10 SASI_Rn02_00267298 predicted 1306
11 SASI_Rn01_00056903 predicted 1945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181989 predicted 939
2 SASI_Mm01_00181990 predicted 1493
3 SASI_Mm01_00181991 predicted 773
4 SASI_Mm02_00324847 predicted 1233
5 SASI_Mm01_00181992 predicted 1410
6 SASI_Mm02_00324848 predicted 1609
7 SASI_Mm01_00181994 predicted 580
8 SASI_Mm01_00181995 predicted 1789
9 SASI_Mm01_00181996 predicted 357
10 SASI_Mm01_00181997 predicted 877
11 SASI_Mm01_00181993 predicted 1566
12 SASI_Mm01_00181998 predicted 1610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005941
VALIDATED
MMP16 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 16 (membrane-inserted)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005941.4-1406s21c1
Sequence:CCGGATGGATACCCAATGCAAATTACTCGAGTAATTTGCATTGGGTATCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-143s1c2
Sequence:CCGGCGGTTGGATTTCGTGCATCATCTCGAGATGATGCACGAAATCCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005941.2-143s1c1
Sequence:CCGGCGGTTGGATTTCGTGCATCATCTCGAGATGATGCACGAAATCCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005941.2-650s1c1
Sequence:CCGGCGTGATGTGGATATAACCATTCTCGAGAATGGTTATATCCACATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-1744s1c1
Sequence:CCGGCCCACCAGATGATGTAGACATCTCGAGATGTCTACATCATCTGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-343s1c1
Sequence:CCGGGCAGTTCTATGGCATTAACATCTCGAGATGTTAATGCCATAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-1277s1c1
Sequence:CCGGCCTCCTAGTATCGATGCAGTTCTCGAGAACTGCATCGATACTAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005941.4-2071s21c1
Sequence:CCGGCTGTACTGTAAACGCTCTATGCTCGAGCATAGAGCGTTTACAGTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005941.4-672s21c1
Sequence:CCGGGCACATCACTTACAGTATAAACTCGAGTTTATACTGTAAGTGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005941
VALIDATED
MMP16 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 16 (membrane-inserted)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005941.4-1406s21c1
Sequence:CCGGATGGATACCCAATGCAAATTACTCGAGTAATTTGCATTGGGTATCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-143s1c2
Sequence:CCGGCGGTTGGATTTCGTGCATCATCTCGAGATGATGCACGAAATCCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005941.2-143s1c1
Sequence:CCGGCGGTTGGATTTCGTGCATCATCTCGAGATGATGCACGAAATCCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005941.2-650s1c1
Sequence:CCGGCGTGATGTGGATATAACCATTCTCGAGAATGGTTATATCCACATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-1744s1c1
Sequence:CCGGCCCACCAGATGATGTAGACATCTCGAGATGTCTACATCATCTGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-343s1c1
Sequence:CCGGGCAGTTCTATGGCATTAACATCTCGAGATGTTAATGCCATAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-1277s1c1
Sequence:CCGGCCTCCTAGTATCGATGCAGTTCTCGAGAACTGCATCGATACTAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005941.4-2071s21c1
Sequence:CCGGCTGTACTGTAAACGCTCTATGCTCGAGCATAGAGCGTTTACAGTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005941.4-672s21c1
Sequence:CCGGGCACATCACTTACAGTATAAACTCGAGTTTATACTGTAAGTGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005941
VALIDATED
MMP16 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 16 (membrane-inserted)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005941.4-1406s21c1
Sequence:CCGGATGGATACCCAATGCAAATTACTCGAGTAATTTGCATTGGGTATCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-143s1c2
Sequence:CCGGCGGTTGGATTTCGTGCATCATCTCGAGATGATGCACGAAATCCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005941.2-143s1c1
Sequence:CCGGCGGTTGGATTTCGTGCATCATCTCGAGATGATGCACGAAATCCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005941.2-650s1c1
Sequence:CCGGCGTGATGTGGATATAACCATTCTCGAGAATGGTTATATCCACATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-1744s1c1
Sequence:CCGGCCCACCAGATGATGTAGACATCTCGAGATGTCTACATCATCTGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-343s1c1
Sequence:CCGGGCAGTTCTATGGCATTAACATCTCGAGATGTTAATGCCATAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005941.2-1277s1c1
Sequence:CCGGCCTCCTAGTATCGATGCAGTTCTCGAGAACTGCATCGATACTAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005941.4-2071s21c1
Sequence:CCGGCTGTACTGTAAACGCTCTATGCTCGAGCATAGAGCGTTTACAGTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005941.4-672s21c1
Sequence:CCGGGCACATCACTTACAGTATAAACTCGAGTTTATACTGTAAGTGATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019724
MMP16 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 16 (membrane-inserted)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-704s1c1
Sequence:CCGGGCCTTTGATGTGTGGCAGAATCTCGAGATTCTGCCACACATCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-2021s1c1
Sequence:CCGGCGCCACATACTGTACTGTAAACTCGAGTTTACAGTACAGTATGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-1409s1c1
Sequence:CCGGCCCAGTATTGATGCAGTTTATCTCGAGATAAACTGCATCAATACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-1874s1c1
Sequence:CCGGCCACCAGATGATGTAGACATTCTCGAGAATGTCTACATCATCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-469s1c1
Sequence:CCGGGCAGCAGTTCTATGGCATTAACTCGAGTTAATGCCATAGAACTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019724
MMP16 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 16 (membrane-inserted)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-704s1c1
Sequence:CCGGGCCTTTGATGTGTGGCAGAATCTCGAGATTCTGCCACACATCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-2021s1c1
Sequence:CCGGCGCCACATACTGTACTGTAAACTCGAGTTTACAGTACAGTATGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-1409s1c1
Sequence:CCGGCCCAGTATTGATGCAGTTTATCTCGAGATAAACTGCATCAATACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-1874s1c1
Sequence:CCGGCCACCAGATGATGTAGACATTCTCGAGAATGTCTACATCATCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-469s1c1
Sequence:CCGGGCAGCAGTTCTATGGCATTAACTCGAGTTAATGCCATAGAACTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019724
MMP16 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 16 (membrane-inserted)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-704s1c1
Sequence:CCGGGCCTTTGATGTGTGGCAGAATCTCGAGATTCTGCCACACATCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-2021s1c1
Sequence:CCGGCGCCACATACTGTACTGTAAACTCGAGTTTACAGTACAGTATGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-1409s1c1
Sequence:CCGGCCCAGTATTGATGCAGTTTATCTCGAGATAAACTGCATCAATACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-1874s1c1
Sequence:CCGGCCACCAGATGATGTAGACATTCTCGAGAATGTCTACATCATCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019724.2-469s1c1
Sequence:CCGGGCAGCAGTTCTATGGCATTAACTCGAGTTAATGCCATAGAACTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)