EMAIL THIS PAGE TO A FRIEND

MMP19

matrix metallopeptidase 19

113 Gene Product Result for
Synonyms: MMP18 RASI-1
UniProtKB ID: Q99542, O15278, O95606, Q99580
Gene ID:
Human(4327) Summary: This gene encodes a member of a family of proteins that are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded protein is secreted as an inactive proprotein, which is activated upon cleavage by extracellular proteases. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Jan 2013]
Mouse(58223) matrix metallopeptidase 19
Rat(304608) matrix metallopeptidase 19
dog(606853) matrix metallopeptidase 19
cow(533203) matrix metallopeptidase 19
domestic cat(101092032) matrix metallopeptidase 19
naked mole-rat(101696939) matrix metallopeptidase 19
Domestic Rabbit(100342188) matrix metallopeptidase 19
domestic guinea pig(100721917) matrix metallopeptidase 19
sheep(101113485) matrix metallopeptidase 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M5309 Anti-Matrix Metalloproteinase-19, C-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
M5434 Anti-Matrix Metalloproteinase-19, Hinge Region antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
M5559 Anti-Matrix Metalloproteinase-19, N-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
M5684 Anti-Matrix Metalloproteinase-19, Propeptide Region antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4501907 Anti-MMP-19 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
AV32314 Anti-MMP19 (AB1) antibody produced in rabbit affinity isolated antibody dog, rat, human
immunohistochemistry, western blot pricing
AV32315 Anti-MMP19 (AB2) antibody produced in rabbit IgG fraction of antiserum human
immunohistochemistry, western blot pricing
SAB1406137 Anti-MMP19 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA012845 Anti-MMP19 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
HPA070804 Anti-MMP19 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002429 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032360 Rosetta Predictions human pricing
NM_002429 Rosetta Predictions human pricing
NM_001107159 Rosetta Predictions rat pricing
NM_021412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244534 predicted 839
2 SASI_Hs01_00244535 predicted 641
3 SASI_Hs01_00244536 predicted 510
4 SASI_Hs01_00244537 predicted 699
5 SASI_Hs01_00244538 predicted 807
6 SASI_Hs01_00244539 predicted 854
7 SASI_Hs01_00244540 predicted 813
8 SASI_Hs01_00244541 predicted 215
9 SASI_Hs01_00244542 predicted 808
10 SASI_Hs01_00244543 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125296 predicted 1178
2 SASI_Hs01_00125297 predicted 1264
3 SASI_Hs02_00333826 predicted 213
4 SASI_Hs01_00125298 predicted 1625
5 SASI_Hs01_00125299 predicted 988
6 SASI_Hs01_00125302 predicted 1041
7 SASI_Hs02_00333827 predicted 237
8 SASI_Hs01_00125304 predicted 1191
9 SASI_Hs01_00125305 predicted 1163
10 SASI_Hs02_00333828 predicted 1292
11 SASI_Hs01_00125300 predicted 860
12 SASI_Hs01_00125301 predicted 1737
13 SASI_Hs01_00125303 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226085 predicted 1123
2 SASI_Rn02_00226086 predicted 1018
3 SASI_Rn02_00226087 predicted 544
4 SASI_Rn02_00226088 predicted 470
5 SASI_Rn02_00226089 predicted 1009
6 SASI_Rn02_00226090 predicted 1307
7 SASI_Rn02_00226091 predicted 1376
8 SASI_Rn02_00226092 predicted 989
9 SASI_Rn02_00226093 predicted 407
10 SASI_Rn02_00226094 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116124 predicted 1002
2 SASI_Mm01_00116125 predicted 1224
3 SASI_Mm01_00116126 predicted 347
4 SASI_Mm01_00116128 predicted 690
5 SASI_Mm01_00116129 predicted 1529
6 SASI_Mm01_00116130 predicted 988
7 SASI_Mm01_00116131 predicted 1315
8 SASI_Mm01_00116132 predicted 817
9 SASI_Mm01_00116133 predicted 1148
10 SASI_Mm02_00326049 predicted 1186
11 SASI_Mm01_00116127 predicted 1332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021412
MMP19 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 19
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021412.2-761s21c1
Sequence:CCGGGACTTGGGCACTCCCGATATACTCGAGTATATCGGGAGTGCCCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021412.2-1330s21c1
Sequence:CCGGGACCTTAGCCGCTACCCTAAACTCGAGTTTAGGGTAGCGGCTAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021412.2-258s21c1
Sequence:CCGGAGATATCACAGAGGCTTTAAGCTCGAGCTTAAAGCCTCTGTGATATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-1625s1c1
Sequence:CCGGTCCCTCTCATTCTCTGCTAATCTCGAGATTAGCAGAGAATGAGAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-1008s1c1
Sequence:CCGGGCGACTATGTGTGGACTGTAACTCGAGTTACAGTCCACACATAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021412.1-1975s1c1
Sequence:CCGGGCTGCCTTGAACTCACAGATACTCGAGTATCTGTGAGTTCAAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-353s1c1
Sequence:CCGGCCCTTCAACCAGAAATCTCTTCTCGAGAAGAGATTTCTGGTTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-1190s1c1
Sequence:CCGGCCCATGAAATTCAACAGAGTACTCGAGTACTCTGTTGAATTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021412
MMP19 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 19
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021412.2-761s21c1
Sequence:CCGGGACTTGGGCACTCCCGATATACTCGAGTATATCGGGAGTGCCCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021412.2-1330s21c1
Sequence:CCGGGACCTTAGCCGCTACCCTAAACTCGAGTTTAGGGTAGCGGCTAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021412.2-258s21c1
Sequence:CCGGAGATATCACAGAGGCTTTAAGCTCGAGCTTAAAGCCTCTGTGATATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-1625s1c1
Sequence:CCGGTCCCTCTCATTCTCTGCTAATCTCGAGATTAGCAGAGAATGAGAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-1008s1c1
Sequence:CCGGGCGACTATGTGTGGACTGTAACTCGAGTTACAGTCCACACATAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021412.1-1975s1c1
Sequence:CCGGGCTGCCTTGAACTCACAGATACTCGAGTATCTGTGAGTTCAAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-353s1c1
Sequence:CCGGCCCTTCAACCAGAAATCTCTTCTCGAGAAGAGATTTCTGGTTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-1190s1c1
Sequence:CCGGCCCATGAAATTCAACAGAGTACTCGAGTACTCTGTTGAATTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021412
MMP19 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 19
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021412.2-761s21c1
Sequence:CCGGGACTTGGGCACTCCCGATATACTCGAGTATATCGGGAGTGCCCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021412.2-1330s21c1
Sequence:CCGGGACCTTAGCCGCTACCCTAAACTCGAGTTTAGGGTAGCGGCTAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021412.2-258s21c1
Sequence:CCGGAGATATCACAGAGGCTTTAAGCTCGAGCTTAAAGCCTCTGTGATATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-1625s1c1
Sequence:CCGGTCCCTCTCATTCTCTGCTAATCTCGAGATTAGCAGAGAATGAGAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-1008s1c1
Sequence:CCGGGCGACTATGTGTGGACTGTAACTCGAGTTACAGTCCACACATAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021412.1-1975s1c1
Sequence:CCGGGCTGCCTTGAACTCACAGATACTCGAGTATCTGTGAGTTCAAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-353s1c1
Sequence:CCGGCCCTTCAACCAGAAATCTCTTCTCGAGAAGAGATTTCTGGTTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021412.1-1190s1c1
Sequence:CCGGCCCATGAAATTCAACAGAGTACTCGAGTACTCTGTTGAATTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002429
VALIDATED
MMP19 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-1193s1c1
Sequence:CCGGGCGCTACATTAATTTCAAGATCTCGAGATCTTGAAATTAATGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-607s1c1
Sequence:CCGGGCTCGTACTGTTCCAATACTTCTCGAGAAGTATTGGAACAGTACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-886s1c1
Sequence:CCGGGCAAGAAGAGTCCAGTGATAACTCGAGTTATCACTGGACTCTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-203s1c1
Sequence:CCGGCGTGGACTACCTGTCACAATACTCGAGTATTGTGACAGGTAGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-1620s1c1
Sequence:CCGGGCCACAGAAACCACGTTTGAACTCGAGTTCAAACGTGGTTTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002429
VALIDATED
MMP19 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-1193s1c1
Sequence:CCGGGCGCTACATTAATTTCAAGATCTCGAGATCTTGAAATTAATGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-607s1c1
Sequence:CCGGGCTCGTACTGTTCCAATACTTCTCGAGAAGTATTGGAACAGTACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-886s1c1
Sequence:CCGGGCAAGAAGAGTCCAGTGATAACTCGAGTTATCACTGGACTCTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-203s1c1
Sequence:CCGGCGTGGACTACCTGTCACAATACTCGAGTATTGTGACAGGTAGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-1620s1c1
Sequence:CCGGGCCACAGAAACCACGTTTGAACTCGAGTTCAAACGTGGTTTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002429
VALIDATED
MMP19 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-1193s1c1
Sequence:CCGGGCGCTACATTAATTTCAAGATCTCGAGATCTTGAAATTAATGTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-607s1c1
Sequence:CCGGGCTCGTACTGTTCCAATACTTCTCGAGAAGTATTGGAACAGTACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-886s1c1
Sequence:CCGGGCAAGAAGAGTCCAGTGATAACTCGAGTTATCACTGGACTCTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-203s1c1
Sequence:CCGGCGTGGACTACCTGTCACAATACTCGAGTATTGTGACAGGTAGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002429.3-1620s1c1
Sequence:CCGGGCCACAGAAACCACGTTTGAACTCGAGTTCAAACGTGGTTTCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)