EMAIL THIS PAGE TO A FRIEND

MMP1

matrix metallopeptidase 1 (interstitial collagenase)

101 Gene Product Result for
Synonyms: CLG CLGN
UniProtKB ID: P03956, P08156
Gene ID:
Human(4312) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. This gene encodes a secreted enzyme which breaks down the interstitial collagens, types I, II, and III. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
Rat(300339) matrix metallopeptidase 1 (interstitial collagenase)
Rat(432357) matrix metalloproteinase 1
sheep(101120355) matrix metallopeptidase 1 (interstitial collagenase)
domestic guinea pig(100727966) matrix metallopeptidase 1 (interstitial collagenase)
naked mole-rat(101697620) matrix metallopeptidase 1 (interstitial collagenase)
Domestic Rabbit(100009110) matrix metallopeptidase 1 (interstitial collagenase)
fruit fly(37949) Matrix metalloproteinase 1
dog(489428) matrix metallopeptidase 1 (interstitial collagenase)
cow(281308) matrix metallopeptidase 1 (interstitial collagenase)
Horse(100033896) matrix metallopeptidase 1 (interstitial collagenase)
chicken(418982) matrix metallopeptidase 1 (interstitial collagenase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M4696 Anti-Matrix Metalloproteinase-1 antibody produced in goat affinity isolated antibody, lyophilized powder human
immunocytochemistry, immunohistochemistry, western blot pricing
M4302 Anti-Matrix Metalloproteinase-1, C-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
M4053 Anti-Matrix Metalloproteinase-1, Hemopexin Domain antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
SAB4501889 Anti-MMP-1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB2108563 Anti-MMP1 IgG fraction of antiserum horse, human
immunohistochemistry, western blot pricing
SAB1105334 Anti-MMP1 (201-215) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105333 Anti-MMP1 (41-55) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
AV42039 Anti-MMP1 (AB1) antibody produced in rabbit IgG fraction of antiserum horse, human
immunohistochemistry, western blot pricing
AV42040 Anti-MMP1 (AB2) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human, bovine, pig, rabbit, rabbit, horse
western blot pricing
SAB4501890 Anti-MMP1 (Cleaved-Phe100) antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB1406131 Anti-MMP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108005 Anti-MMP1 antibody produced in rabbit IgG fraction of antiserum rabbit, horse, bovine, pig, human, rabbit, guinea pig
immunohistochemistry, western blot pricing
HPA004920 Anti-MMP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1402846 Monoclonal Anti-MMP1, (C-terminal) antibody produced in mouse clone 2E11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
P5298 Pro-Leu-Gly hydroxamate hydrochloride human pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
C4361 Collagen Type I−FITC Conjugate from bovine skin ~1 mg/mL, solution cow, human, mouse, rat pricing

Kits

Product # Description Species Add to Cart
 
MAK212 MMP-1 Inhibitor Screening Kit Sufficient for 100 Fluorometric tests human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002421 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005681 MISSION® esiRNA esiRNA targeting human MMP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002421 Rosetta Predictions human pricing
NM_001134530 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110300 predicted 1052
2 SASI_Hs02_00333814 predicted 1392
3 SASI_Hs01_00110301 predicted 1182
4 SASI_Hs01_00110302 predicted 664
5 SASI_Hs01_00110303 predicted 912
6 SASI_Hs01_00110304 predicted 992
7 SASI_Hs01_00110305 predicted 960
8 SASI_Hs01_00110306 predicted 265
9 SASI_Hs01_00110307 predicted 603
10 SASI_Hs02_00333815 predicted 959
11 SASI_Hs01_00110308 predicted 1452
12 SASI_Hs01_00110309 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256789 predicted 322
2 SASI_Rn02_00256790 predicted 909
3 SASI_Rn02_00256791 predicted 1355
4 SASI_Rn02_00256792 predicted 1015
5 SASI_Rn02_00256793 predicted 1076
6 SASI_Rn02_00256794 predicted 1156
7 SASI_Rn02_00256795 predicted 544
8 SASI_Rn02_00256796 predicted 1363
9 SASI_Rn02_00256797 predicted 1444
10 SASI_Rn02_00256798 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002421
MMP1 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 1 (interstitial collagenase)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002421.3-1125s21c1
Sequence:CCGGCTTGAAGCTGCTTACGAATTTCTCGAGAAATTCGTAAGCAGCTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002421.3-986s21c1
Sequence:CCGGGCTAACCTTTGATGCTATAACCTCGAGGTTATAGCATCAAAGGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002421.x-665s1c1
Sequence:CCGGTGAAGATGAAAGGTGGACCAACTCGAGTTGGTCCACCTTTCATCTTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002421.x-1702s1c1
Sequence:CCGGGTTTGTGGCTTATGGATTCATCTCGAGATGAATCCATAAGCCACAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002421.x-1181s1c1
Sequence:CCGGCCCTAGAACTGTGAAGCATATCTCGAGATATGCTTCACAGTTCTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002421.x-683s1c1
Sequence:CCGGCAACAATTTCAGAGAGTACAACTCGAGTTGTACTCTCTGAAATTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002421
MMP1 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 1 (interstitial collagenase)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002421.3-1125s21c1
Sequence:CCGGCTTGAAGCTGCTTACGAATTTCTCGAGAAATTCGTAAGCAGCTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002421.3-986s21c1
Sequence:CCGGGCTAACCTTTGATGCTATAACCTCGAGGTTATAGCATCAAAGGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002421.x-665s1c1
Sequence:CCGGTGAAGATGAAAGGTGGACCAACTCGAGTTGGTCCACCTTTCATCTTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002421.x-1702s1c1
Sequence:CCGGGTTTGTGGCTTATGGATTCATCTCGAGATGAATCCATAAGCCACAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002421.x-1181s1c1
Sequence:CCGGCCCTAGAACTGTGAAGCATATCTCGAGATATGCTTCACAGTTCTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002421.x-683s1c1
Sequence:CCGGCAACAATTTCAGAGAGTACAACTCGAGTTGTACTCTCTGAAATTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002421
MMP1 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 1 (interstitial collagenase)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002421.3-1125s21c1
Sequence:CCGGCTTGAAGCTGCTTACGAATTTCTCGAGAAATTCGTAAGCAGCTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002421.3-986s21c1
Sequence:CCGGGCTAACCTTTGATGCTATAACCTCGAGGTTATAGCATCAAAGGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002421.x-665s1c1
Sequence:CCGGTGAAGATGAAAGGTGGACCAACTCGAGTTGGTCCACCTTTCATCTTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003336    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002421.x-1702s1c1
Sequence:CCGGGTTTGTGGCTTATGGATTCATCTCGAGATGAATCCATAAGCCACAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002421.x-1181s1c1
Sequence:CCGGCCCTAGAACTGTGAAGCATATCTCGAGATATGCTTCACAGTTCTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002421.x-683s1c1
Sequence:CCGGCAACAATTTCAGAGAGTACAACTCGAGTTGTACTCTCTGAAATTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)