EMAIL THIS PAGE TO A FRIEND

MMP20

matrix metallopeptidase 20

56 Gene Product Result for
Synonyms: AI2A2 MMP-20
UniProtKB ID: O60882, Q6DKT9
Gene ID:
Human(9313) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The protein encoded by this gene degrades amelogenin, the major protein component of dental enamel matrix, and thus thought to play a role in tooth enamel formation. A mutation in this gene, which alters the normal splice pattern and results in premature termination of the encoded protein, has been associated with amelogenesis imperfecta. This gene is part of a cluster of MMP genes located on chromosome 11q22.3. [provided by RefSeq, Aug 2011]
Mouse(30800) matrix metallopeptidase 20 (enamelysin)
Rat(300341) matrix metallopeptidase 20
dog(611829) matrix metallopeptidase 20
domestic cat(101080734) matrix metallopeptidase 20
cow(281916) matrix metallopeptidase 20
sheep(101119666) matrix metallopeptidase 20
naked mole-rat(101717548) matrix metallopeptidase 20
domestic guinea pig(100719984) matrix metallopeptidase 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004771 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001641 MISSION® esiRNA esiRNA targeting human MMP20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004771 Rosetta Predictions human pricing
NM_001106800 Rosetta Predictions rat pricing
NM_013903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138584 predicted 565
2 SASI_Hs01_00138585 predicted 813
3 SASI_Hs01_00138586 predicted 1385
4 SASI_Hs01_00138587 predicted 731
5 SASI_Hs01_00138588 predicted 1473
6 SASI_Hs01_00138589 predicted 1407
7 SASI_Hs02_00338275 predicted 1241
8 SASI_Hs01_00138591 predicted 1289
9 SASI_Hs02_00338276 predicted 1556
10 SASI_Hs02_00338277 predicted 1550
11 SASI_Hs01_00138590 predicted 1357
12 SASI_Hs01_00138592 predicted 1330
13 SASI_Hs01_00138593 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222528 predicted 654
2 SASI_Rn02_00222529 predicted 1517
3 SASI_Rn02_00222530 predicted 1528
4 SASI_Rn02_00222531 predicted 1537
5 SASI_Rn02_00222532 predicted 937
6 SASI_Rn02_00222533 predicted 1540
7 SASI_Rn02_00222534 predicted 677
8 SASI_Rn02_00222535 predicted 1009
9 SASI_Rn02_00222536 predicted 808
10 SASI_Rn02_00222537 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078234 predicted 1928
2 SASI_Mm01_00078235 predicted 1846
3 SASI_Mm01_00078236 predicted 1897
4 SASI_Mm01_00078237 predicted 739
5 SASI_Mm01_00078238 predicted 1917
6 SASI_Mm01_00078240 predicted 804
7 SASI_Mm01_00078241 predicted 1828
8 SASI_Mm01_00078242 predicted 1797
9 SASI_Mm01_00078243 predicted 1908
10 SASI_Mm02_00322986 predicted 1847
11 SASI_Mm01_00078239 predicted 1798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004771
MMP20 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004771.3-1710s21c1
Sequence:CCGGTGCAGTTAGACACCATTATTTCTCGAGAAATAATGGTGTCTAACTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004771.3-615s21c1
Sequence:CCGGGAGATACACATTTCGACAATGCTCGAGCATTGTCGAAATGTGTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004771.3-1797s21c1
Sequence:CCGGGTGGATTCCATGACATATATTCTCGAGAATATATGTCATGGAATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-1298s1c1
Sequence:CCGGCCAAAGAATACTGAAGAAGAACTCGAGTTCTTCTTCAGTATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-748s1c1
Sequence:CCGGCCCAACTTATAAGTACAAGAACTCGAGTTCTTGTACTTATAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-134s1c1
Sequence:CCGGGCACAGGCGTATCTTGACAAACTCGAGTTTGTCAAGATACGCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-277s1c1
Sequence:CCGGCCAGACCACAATGAACGTGATCTCGAGATCACGTTCATTGTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-485s1c1
Sequence:CCGGGTCAGAATAAACTCAGGAGAACTCGAGTTCTCCTGAGTTTATTCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004771
MMP20 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004771.3-1710s21c1
Sequence:CCGGTGCAGTTAGACACCATTATTTCTCGAGAAATAATGGTGTCTAACTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004771.3-615s21c1
Sequence:CCGGGAGATACACATTTCGACAATGCTCGAGCATTGTCGAAATGTGTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004771.3-1797s21c1
Sequence:CCGGGTGGATTCCATGACATATATTCTCGAGAATATATGTCATGGAATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-1298s1c1
Sequence:CCGGCCAAAGAATACTGAAGAAGAACTCGAGTTCTTCTTCAGTATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-748s1c1
Sequence:CCGGCCCAACTTATAAGTACAAGAACTCGAGTTCTTGTACTTATAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-134s1c1
Sequence:CCGGGCACAGGCGTATCTTGACAAACTCGAGTTTGTCAAGATACGCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-277s1c1
Sequence:CCGGCCAGACCACAATGAACGTGATCTCGAGATCACGTTCATTGTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-485s1c1
Sequence:CCGGGTCAGAATAAACTCAGGAGAACTCGAGTTCTCCTGAGTTTATTCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004771
MMP20 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425076    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004771.3-1710s21c1
Sequence:CCGGTGCAGTTAGACACCATTATTTCTCGAGAAATAATGGTGTCTAACTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004771.3-615s21c1
Sequence:CCGGGAGATACACATTTCGACAATGCTCGAGCATTGTCGAAATGTGTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004771.3-1797s21c1
Sequence:CCGGGTGGATTCCATGACATATATTCTCGAGAATATATGTCATGGAATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-1298s1c1
Sequence:CCGGCCAAAGAATACTGAAGAAGAACTCGAGTTCTTCTTCAGTATTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-748s1c1
Sequence:CCGGCCCAACTTATAAGTACAAGAACTCGAGTTCTTGTACTTATAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-134s1c1
Sequence:CCGGGCACAGGCGTATCTTGACAAACTCGAGTTTGTCAAGATACGCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-277s1c1
Sequence:CCGGCCAGACCACAATGAACGTGATCTCGAGATCACGTTCATTGTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004771.3-485s1c1
Sequence:CCGGGTCAGAATAAACTCAGGAGAACTCGAGTTCTCCTGAGTTTATTCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013903
MMP20 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 20
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-743s1c1
Sequence:CCGGGCACTGATGTACCCAACTTATCTCGAGATAAGTTGGGTACATCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-1181s1c1
Sequence:CCGGCCAAGGCATGTGCAACGAATACTCGAGTATTCGTTGCACATGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-283s1c1
Sequence:CCGGCCAGAATACAATGAATGTGATCTCGAGATCACATTCATTGTATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-146s1c1
Sequence:CCGGGCCTATCTTGACAAGTATTATCTCGAGATAATACTTGTCAAGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-479s1c1
Sequence:CCGGCCTCTGAACTTCGTTAGAATACTCGAGTATTCTAACGAAGTTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013903
MMP20 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 20
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-743s1c1
Sequence:CCGGGCACTGATGTACCCAACTTATCTCGAGATAAGTTGGGTACATCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-1181s1c1
Sequence:CCGGCCAAGGCATGTGCAACGAATACTCGAGTATTCGTTGCACATGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-283s1c1
Sequence:CCGGCCAGAATACAATGAATGTGATCTCGAGATCACATTCATTGTATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-146s1c1
Sequence:CCGGGCCTATCTTGACAAGTATTATCTCGAGATAATACTTGTCAAGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-479s1c1
Sequence:CCGGCCTCTGAACTTCGTTAGAATACTCGAGTATTCTAACGAAGTTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013903
MMP20 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 20
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-743s1c1
Sequence:CCGGGCACTGATGTACCCAACTTATCTCGAGATAAGTTGGGTACATCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-1181s1c1
Sequence:CCGGCCAAGGCATGTGCAACGAATACTCGAGTATTCGTTGCACATGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-283s1c1
Sequence:CCGGCCAGAATACAATGAATGTGATCTCGAGATCACATTCATTGTATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-146s1c1
Sequence:CCGGGCCTATCTTGACAAGTATTATCTCGAGATAATACTTGTCAAGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013903.1-479s1c1
Sequence:CCGGCCTCTGAACTTCGTTAGAATACTCGAGTATTCTAACGAAGTTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)