EMAIL THIS PAGE TO A FRIEND

MMP21

matrix metallopeptidase 21

56 Gene Product Result for
Synonyms: MMP-21
UniProtKB ID: Q8N119, Q5VZP9, Q8NG02
Gene ID:
Human(118856) Summary: This gene encodes a member of the matrix metalloproteinase family. Proteins in this family are involved in the breakdown of extracellular matrix for both normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, and disease processes, such as asthma and tumor metastasis. The encoded protein may play an important role in embryogenesis, particularly in neuronal cells, as well as in lymphocyte development and survival. [provided by RefSeq, May 2013]
Mouse(214766) matrix metallopeptidase 21
Rat(293573) matrix metallopeptidase 21
domestic guinea pig(100733377) matrix metallopeptidase 21
naked mole-rat(101722010) matrix metallopeptidase 21
domestic cat(101080328) matrix metallopeptidase 21
Horse(100056496) matrix metallopeptidase 21
dog(611418) matrix metallopeptidase 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_147191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147191 Rosetta Predictions human pricing
NM_001106308 Rosetta Predictions rat pricing
NM_152944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233641 predicted 1056
2 SASI_Hs01_00233642 predicted 1005
3 SASI_Hs01_00233643 predicted 1674
4 SASI_Hs01_00233644 predicted 1572
5 SASI_Hs01_00233645 predicted 1308
6 SASI_Hs01_00233646 predicted 1099
7 SASI_Hs01_00233647 predicted 1171
8 SASI_Hs01_00233648 predicted 1408
9 SASI_Hs01_00233649 predicted 1504
10 SASI_Hs01_00233650 predicted 1561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106308 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217698 predicted 261
2 SASI_Rn02_00217699 predicted 1289
3 SASI_Rn02_00217700 predicted 1478
4 SASI_Rn02_00217701 predicted 985
5 SASI_Rn02_00217702 predicted 998
6 SASI_Rn02_00217703 predicted 982
7 SASI_Rn02_00217704 predicted 1600
8 SASI_Rn02_00217705 predicted 1112
9 SASI_Rn02_00217706 predicted 316
10 SASI_Rn02_00217707 predicted 1219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148999 predicted 1528
2 SASI_Mm01_00149000 predicted 1245
3 SASI_Mm01_00149001 predicted 1265
4 SASI_Mm01_00149002 predicted 1444
5 SASI_Mm01_00149003 predicted 1479
6 SASI_Mm01_00149004 predicted 1113
7 SASI_Mm02_00342843 predicted 311
8 SASI_Mm01_00149005 predicted 267
9 SASI_Mm01_00149006 predicted 976
10 SASI_Mm01_00149007 predicted 1260
11 SASI_Mm01_00149008 predicted 1014
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152944
MMP21 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1481s1c1
Sequence:CCGGGCCAAGTGTTTCCAGCAATAACTCGAGTTATTGCTGGAAACACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1288s1c1
Sequence:CCGGGCACACACAGAAGACGAACAACTCGAGTTGTTCGTCTTCTGTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1033s1c1
Sequence:CCGGCGCAAGGAGAGGAACCAATATCTCGAGATATTGGTTCCTCTCCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-201s1c1
Sequence:CCGGGTCAGAGATACCTAGCCCAAACTCGAGTTTGGGCTAGGTATCTCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1632s1c1
Sequence:CCGGGCTGCCTCTGAATGGCTTATTCTCGAGAATAAGCCATTCAGAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152944
MMP21 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1481s1c1
Sequence:CCGGGCCAAGTGTTTCCAGCAATAACTCGAGTTATTGCTGGAAACACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1288s1c1
Sequence:CCGGGCACACACAGAAGACGAACAACTCGAGTTGTTCGTCTTCTGTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1033s1c1
Sequence:CCGGCGCAAGGAGAGGAACCAATATCTCGAGATATTGGTTCCTCTCCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-201s1c1
Sequence:CCGGGTCAGAGATACCTAGCCCAAACTCGAGTTTGGGCTAGGTATCTCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1632s1c1
Sequence:CCGGGCTGCCTCTGAATGGCTTATTCTCGAGAATAAGCCATTCAGAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152944
MMP21 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1481s1c1
Sequence:CCGGGCCAAGTGTTTCCAGCAATAACTCGAGTTATTGCTGGAAACACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1288s1c1
Sequence:CCGGGCACACACAGAAGACGAACAACTCGAGTTGTTCGTCTTCTGTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1033s1c1
Sequence:CCGGCGCAAGGAGAGGAACCAATATCTCGAGATATTGGTTCCTCTCCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-201s1c1
Sequence:CCGGGTCAGAGATACCTAGCCCAAACTCGAGTTTGGGCTAGGTATCTCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152944.1-1632s1c1
Sequence:CCGGGCTGCCTCTGAATGGCTTATTCTCGAGAATAAGCCATTCAGAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147191
MMP21 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1108s1c1
Sequence:CCGGCGAAACAATAGGACACGCTATCTCGAGATAGCGTGTCCTATTGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1620s1c1
Sequence:CCGGGCTTCCTGCTAATGGCTTATTCTCGAGAATAAGCCATTAGCAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1371s1c1
Sequence:CCGGCCGAAGACAGAAGTTAATTTACTCGAGTAAATTAACTTCTGTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1524s1c1
Sequence:CCGGCGCTTATTACTCCTATGCATACTCGAGTATGCATAGGAGTAATAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1310s1c1
Sequence:CCGGCCAAATTGATTTCAGAAGGATCTCGAGATCCTTCTGAAATCAATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147191.1-1671s21c1
Sequence:CCGGTGATGTTTGTGACGTCCATATCTCGAGATATGGACGTCACAAACATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147191.1-1573s21c1
Sequence:CCGGGCATACTGGAAGGTAGTTAATCTCGAGATTAACTACCTTCCAGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147191.1-980s21c1
Sequence:CCGGGCTCCTGTGAGGGATCATTTGCTCGAGCAAATGATCCCTCACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147191
MMP21 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1108s1c1
Sequence:CCGGCGAAACAATAGGACACGCTATCTCGAGATAGCGTGTCCTATTGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1620s1c1
Sequence:CCGGGCTTCCTGCTAATGGCTTATTCTCGAGAATAAGCCATTAGCAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1371s1c1
Sequence:CCGGCCGAAGACAGAAGTTAATTTACTCGAGTAAATTAACTTCTGTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1524s1c1
Sequence:CCGGCGCTTATTACTCCTATGCATACTCGAGTATGCATAGGAGTAATAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1310s1c1
Sequence:CCGGCCAAATTGATTTCAGAAGGATCTCGAGATCCTTCTGAAATCAATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147191.1-1671s21c1
Sequence:CCGGTGATGTTTGTGACGTCCATATCTCGAGATATGGACGTCACAAACATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147191.1-1573s21c1
Sequence:CCGGGCATACTGGAAGGTAGTTAATCTCGAGATTAACTACCTTCCAGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147191.1-980s21c1
Sequence:CCGGGCTCCTGTGAGGGATCATTTGCTCGAGCAAATGATCCCTCACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147191
MMP21 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1108s1c1
Sequence:CCGGCGAAACAATAGGACACGCTATCTCGAGATAGCGTGTCCTATTGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1620s1c1
Sequence:CCGGGCTTCCTGCTAATGGCTTATTCTCGAGAATAAGCCATTAGCAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1371s1c1
Sequence:CCGGCCGAAGACAGAAGTTAATTTACTCGAGTAAATTAACTTCTGTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1524s1c1
Sequence:CCGGCGCTTATTACTCCTATGCATACTCGAGTATGCATAGGAGTAATAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147191.1-1310s1c1
Sequence:CCGGCCAAATTGATTTCAGAAGGATCTCGAGATCCTTCTGAAATCAATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147191.1-1671s21c1
Sequence:CCGGTGATGTTTGTGACGTCCATATCTCGAGATATGGACGTCACAAACATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147191.1-1573s21c1
Sequence:CCGGGCATACTGGAAGGTAGTTAATCTCGAGATTAACTACCTTCCAGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147191.1-980s21c1
Sequence:CCGGGCTCCTGTGAGGGATCATTTGCTCGAGCAAATGATCCCTCACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)