EMAIL THIS PAGE TO A FRIEND

MMP23B

matrix metallopeptidase 23B

33 Gene Product Result for
Synonyms: MIFR MIFR-1 MMP22 MMP23A
Gene ID:
Human(8510) Summary: This gene (MMP23B) encodes a member of the matrix metalloproteinase (MMP) family, and it is part of a duplicated region of chromosome 1p36.3. Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. This gene belongs to the more telomeric copy of the duplicated region. [provided by RefSeq, Jul 2008]
chicken(419407) matrix metallopeptidase 23B
cow(527590) matrix metallopeptidase 23B
domestic cat(101087564) matrix metallopeptidase 23B
dog(607187) matrix metallopeptidase 23B
naked mole-rat(101713670) matrix metallopeptidase 23B
domestic guinea pig(100712958) matrix metallopeptidase 23B
sheep(101102504) matrix metallopeptidase 23B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M4191 Anti-Matrix Metalloproteinase-22, C-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
M4066 Anti-Matrix Metalloproteinase-22, Hinge Region antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
M4316 Anti-Matrix Metalloproteinase-22, N-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
M3941 Anti-Matrix Metalloproteinase-22, Propeptide Region antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
M6184 Anti-Matrix Metalloproteinase-23, C-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4503401 Anti-MMP-23 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4503402 Anti-MMP23 (Cleaved-Tyr79) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
AV46808 Anti-MMP23B antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2103334 Anti-MMP23B antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0008510M1 Monoclonal Anti-MMP23B antibody produced in mouse clone 200, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1404589 Monoclonal Anti-MMP23B antibody produced in mouse clone 1D8, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006983 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006983 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342719 predicted 683
2 SASI_Hs01_00137401 predicted 891
3 SASI_Hs01_00137402 predicted 708
4 SASI_Hs01_00137403 predicted 849
5 SASI_Hs01_00137404 predicted 457
6 SASI_Hs01_00137405 predicted 559
7 SASI_Hs01_00137406 predicted 712
8 SASI_Hs01_00137407 predicted 568
9 SASI_Hs01_00137408 predicted 684
10 SASI_Hs01_00137409 predicted 734
11 SASI_Hs01_00137410 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006983
MMP23B MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 23B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-1025s1c1
Sequence:CCGGAGGGAAAGTGTACTGGTACAACTCGAGTTGTACCAGTACACTTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-893s1c1
Sequence:CCGGCTGCGACTTCTGCTACGAATTCTCGAGAATTCGTAGCAGAAGTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-575s1c1
Sequence:CCGGCCACTTCGACGACAGCGAGTACTCGAGTACTCGCTGTCGTCGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-461s1c1
Sequence:CCGGGATAGGCTTCTACCCGATCAACTCGAGTTGATCGGGTAGAAGCCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-317s1c1
Sequence:CCGGCACCTACAGGATCCTCTCCTTCTCGAGAAGGAGAGGATCCTGTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006983.1-1006s21c1
Sequence:CCGGAGAAGATCCTCCACAAGAAAGCTCGAGCTTTCTTGTGGAGGATCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006983.1-305s21c1
Sequence:CCGGCCACTTCAACCTCACCTACAGCTCGAGCTGTAGGTGAGGTTGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006983.1-1126s21c1
Sequence:CCGGTCAATGAGGGCACCTACACCTCTCGAGAGGTGTAGGTGCCCTCATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006983
MMP23B MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 23B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-1025s1c1
Sequence:CCGGAGGGAAAGTGTACTGGTACAACTCGAGTTGTACCAGTACACTTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-893s1c1
Sequence:CCGGCTGCGACTTCTGCTACGAATTCTCGAGAATTCGTAGCAGAAGTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-575s1c1
Sequence:CCGGCCACTTCGACGACAGCGAGTACTCGAGTACTCGCTGTCGTCGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-461s1c1
Sequence:CCGGGATAGGCTTCTACCCGATCAACTCGAGTTGATCGGGTAGAAGCCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-317s1c1
Sequence:CCGGCACCTACAGGATCCTCTCCTTCTCGAGAAGGAGAGGATCCTGTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006983.1-1006s21c1
Sequence:CCGGAGAAGATCCTCCACAAGAAAGCTCGAGCTTTCTTGTGGAGGATCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006983.1-305s21c1
Sequence:CCGGCCACTTCAACCTCACCTACAGCTCGAGCTGTAGGTGAGGTTGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006983.1-1126s21c1
Sequence:CCGGTCAATGAGGGCACCTACACCTCTCGAGAGGTGTAGGTGCCCTCATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006983
MMP23B MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 23B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-1025s1c1
Sequence:CCGGAGGGAAAGTGTACTGGTACAACTCGAGTTGTACCAGTACACTTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-893s1c1
Sequence:CCGGCTGCGACTTCTGCTACGAATTCTCGAGAATTCGTAGCAGAAGTCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-575s1c1
Sequence:CCGGCCACTTCGACGACAGCGAGTACTCGAGTACTCGCTGTCGTCGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-461s1c1
Sequence:CCGGGATAGGCTTCTACCCGATCAACTCGAGTTGATCGGGTAGAAGCCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006983.1-317s1c1
Sequence:CCGGCACCTACAGGATCCTCTCCTTCTCGAGAAGGAGAGGATCCTGTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006983.1-1006s21c1
Sequence:CCGGAGAAGATCCTCCACAAGAAAGCTCGAGCTTTCTTGTGGAGGATCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006983.1-305s21c1
Sequence:CCGGCCACTTCAACCTCACCTACAGCTCGAGCTGTAGGTGAGGTTGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006983.1-1126s21c1
Sequence:CCGGTCAATGAGGGCACCTACACCTCTCGAGAGGTGTAGGTGCCCTCATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)