EMAIL THIS PAGE TO A FRIEND

MMP24

matrix metallopeptidase 24 (membrane-inserted)

222 Gene Product Result for
Synonyms: MMP-24 MMP25 MT-MMP 5 MT-MMP5 MT5-MMP MT5MMP MTMMP5
UniProtKB ID: Q9Y5R2, B7ZBG8, Q9H440
Gene ID:
Human(10893) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the protein encoded by this gene is a member of the membrane-type MMP (MT-MMP) subfamily; each member of this subfamily contains a potential transmembrane domain suggesting that these proteins are expressed at the cell surface rather than secreted. This protein activates MMP2 by cleavage. The gene has previously been referred to as MMP25 but has been renamed MMP24. [provided by RefSeq, Jul 2008]
Mouse(17391) matrix metallopeptidase 24
Rat(83513) matrix metallopeptidase 24
Zebrafish(571143) matrix metallopeptidase 24
chicken(419141) matrix metallopeptidase 24 (membrane-inserted)
dog(485849) matrix metallopeptidase 24 (membrane-inserted)
domestic cat(101087914) matrix metallopeptidase 24 (membrane-inserted)
cow(536622) matrix metallopeptidase 24 (membrane-inserted)
Horse(100069462) matrix metallopeptidase 24 (membrane-inserted)
sheep(101119580) matrix metallopeptidase 24 (membrane-inserted)
domestic guinea pig(100731826) matrix metallopeptidase 24 (membrane-inserted)
naked mole-rat(101702877) matrix metallopeptidase 24 (membrane-inserted)
Domestic Rabbit(100328896) matrix metallopeptidase 24 (membrane-inserted)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006690 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006690 Rosetta Predictions human pricing
NM_031757 Rosetta Predictions rat pricing
NM_010808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021934 predicted 1620
2 SASI_Hs02_00342101 predicted 1035
3 SASI_Hs01_00021935 predicted 600
4 SASI_Hs01_00021936 predicted 1315
5 SASI_Hs01_00021938 predicted 2249
6 SASI_Hs02_00342102 predicted 2163
7 SASI_Hs01_00021939 predicted 464
8 SASI_Hs01_00021940 predicted 610
9 SASI_Hs02_00342103 predicted 1478
10 SASI_Hs01_00021942 predicted 1333
11 SASI_Hs01_00021937 predicted 769
12 SASI_Hs01_00021941 predicted 2175
13 SASI_Hs01_00021943 predicted 1849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081915 predicted 1326
2 SASI_Rn02_00265171 predicted 583
3 SASI_Rn01_00081916 predicted 1234
4 SASI_Rn01_00081918 predicted 624
5 SASI_Rn01_00081919 predicted 1617
6 SASI_Rn01_00081920 predicted 1344
7 SASI_Rn01_00081921 predicted 1301
8 SASI_Rn01_00081922 predicted 1268
9 SASI_Rn01_00081924 predicted 1637
10 SASI_Rn02_00265172 predicted 779
11 SASI_Rn01_00081917 predicted 913
12 SASI_Rn01_00081923 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072017 predicted 811
2 SASI_Mm01_00072018 predicted 505
3 SASI_Mm01_00072019 predicted 757
4 SASI_Mm01_00072020 predicted 1352
5 SASI_Mm01_00072021 predicted 505
6 SASI_Mm01_00072022 predicted 1256
7 SASI_Mm01_00072023 predicted 932
8 SASI_Mm01_00072024 predicted 651
9 SASI_Mm01_00072025 predicted 1330
10 SASI_Mm01_00072026 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006690
VALIDATED
MMP24 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 24 (membrane-inserted)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006690.3-2063s21c1
Sequence:CCGGAGCTGAAGTGGTGGGTGCATTCTCGAGAATGCACCCACCACTTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006690.3-1949s21c1
Sequence:CCGGAGAGCCCTCTCTATCCACTTGCTCGAGCAAGTGGATAGAGAGGGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006690.3-1206s21c1
Sequence:CCGGGTTCTGGCGTCTGCGCAATAACTCGAGTTATTGCGCAGACGCCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-509s1c1
Sequence:CCGGCCTACAGCATTCACAACTATACTCGAGTATAGTTGTGAATGCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-1311s1c1
Sequence:CCGGCGATGGGAGATTTGTCTTCTTCTCGAGAAGAAGACAAATCTCCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-1894s1c1
Sequence:CCGGCCTCAGCCTGTCACCTACTATCTCGAGATAGTAGGTGACAGGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-252s1c1
Sequence:CCGGCTGGTTAAAGTCCTATGGCTACTCGAGTAGCCATAGGACTTTAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006690.3-2170s21c1
Sequence:CCGGGGCAAACTACTCCCTACTTAACTCGAGTTAAGTAGGGAGTAGTTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-1595s1c1
Sequence:CCGGAGGAAGGATATTACACCTATTCTCGAGAATAGGTGTAATATCCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006690
VALIDATED
MMP24 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 24 (membrane-inserted)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006690.3-2063s21c1
Sequence:CCGGAGCTGAAGTGGTGGGTGCATTCTCGAGAATGCACCCACCACTTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006690.3-1949s21c1
Sequence:CCGGAGAGCCCTCTCTATCCACTTGCTCGAGCAAGTGGATAGAGAGGGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006690.3-1206s21c1
Sequence:CCGGGTTCTGGCGTCTGCGCAATAACTCGAGTTATTGCGCAGACGCCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-509s1c1
Sequence:CCGGCCTACAGCATTCACAACTATACTCGAGTATAGTTGTGAATGCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-1311s1c1
Sequence:CCGGCGATGGGAGATTTGTCTTCTTCTCGAGAAGAAGACAAATCTCCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-1894s1c1
Sequence:CCGGCCTCAGCCTGTCACCTACTATCTCGAGATAGTAGGTGACAGGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-252s1c1
Sequence:CCGGCTGGTTAAAGTCCTATGGCTACTCGAGTAGCCATAGGACTTTAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006690.3-2170s21c1
Sequence:CCGGGGCAAACTACTCCCTACTTAACTCGAGTTAAGTAGGGAGTAGTTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-1595s1c1
Sequence:CCGGAGGAAGGATATTACACCTATTCTCGAGAATAGGTGTAATATCCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006690
VALIDATED
MMP24 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 24 (membrane-inserted)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006690.3-2063s21c1
Sequence:CCGGAGCTGAAGTGGTGGGTGCATTCTCGAGAATGCACCCACCACTTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006690.3-1949s21c1
Sequence:CCGGAGAGCCCTCTCTATCCACTTGCTCGAGCAAGTGGATAGAGAGGGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006690.3-1206s21c1
Sequence:CCGGGTTCTGGCGTCTGCGCAATAACTCGAGTTATTGCGCAGACGCCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-509s1c1
Sequence:CCGGCCTACAGCATTCACAACTATACTCGAGTATAGTTGTGAATGCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-1311s1c1
Sequence:CCGGCGATGGGAGATTTGTCTTCTTCTCGAGAAGAAGACAAATCTCCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-1894s1c1
Sequence:CCGGCCTCAGCCTGTCACCTACTATCTCGAGATAGTAGGTGACAGGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-252s1c1
Sequence:CCGGCTGGTTAAAGTCCTATGGCTACTCGAGTAGCCATAGGACTTTAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419421    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006690.3-2170s21c1
Sequence:CCGGGGCAAACTACTCCCTACTTAACTCGAGTTAAGTAGGGAGTAGTTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006690.2-1595s1c1
Sequence:CCGGAGGAAGGATATTACACCTATTCTCGAGAATAGGTGTAATATCCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010808
MMP24 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 24 (membrane-inserted)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-1848s1c1
Sequence:CCGGGCTCTACACTATCTTCCAATTCTCGAGAATTGGAAGATAGTGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-500s1c1
Sequence:CCGGCCTACAGCATTCACAATTATACTCGAGTATAATTGTGAATGCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-1270s1c1
Sequence:CCGGGCCCGCATAGACGCAGCCTATCTCGAGATAGGCTGCGTCTATGCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-441s1c1
Sequence:CCGGGAGGAGGAGAAATAAGCGATACTCGAGTATCGCTTATTTCTCCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-610s1c1
Sequence:CCGGGTGCCATACCATGAGATCAAACTCGAGTTTGATCTCATGGTATGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010808
MMP24 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 24 (membrane-inserted)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-1848s1c1
Sequence:CCGGGCTCTACACTATCTTCCAATTCTCGAGAATTGGAAGATAGTGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-500s1c1
Sequence:CCGGCCTACAGCATTCACAATTATACTCGAGTATAATTGTGAATGCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-1270s1c1
Sequence:CCGGGCCCGCATAGACGCAGCCTATCTCGAGATAGGCTGCGTCTATGCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-441s1c1
Sequence:CCGGGAGGAGGAGAAATAAGCGATACTCGAGTATCGCTTATTTCTCCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-610s1c1
Sequence:CCGGGTGCCATACCATGAGATCAAACTCGAGTTTGATCTCATGGTATGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010808
MMP24 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 24 (membrane-inserted)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-1848s1c1
Sequence:CCGGGCTCTACACTATCTTCCAATTCTCGAGAATTGGAAGATAGTGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-500s1c1
Sequence:CCGGCCTACAGCATTCACAATTATACTCGAGTATAATTGTGAATGCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-1270s1c1
Sequence:CCGGGCCCGCATAGACGCAGCCTATCTCGAGATAGGCTGCGTCTATGCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-441s1c1
Sequence:CCGGGAGGAGGAGAAATAAGCGATACTCGAGTATCGCTTATTTCTCCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010808.1-610s1c1
Sequence:CCGGGTGCCATACCATGAGATCAAACTCGAGTTTGATCTCATGGTATGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)