EMAIL THIS PAGE TO A FRIEND

MMP25

matrix metallopeptidase 25

102 Gene Product Result for
Synonyms: MMP-25 MMP20 MMP20A MMPL1 MT-MMP 6 MT-MMP6 MT6-MMP MT6MMP MTMMP6
UniProtKB ID: Q9NPA2, D3DUA8, Q9H3Q0
Gene ID:
Human(64386) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMPs are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the protein encoded by this gene is a member of the membrane-type MMP (MT-MMP) subfamily, attached to the plasma membrane via a glycosylphosphatidyl inositol anchor. In response to bacterial infection or inflammation, the encoded protein is thought to inactivate alpha-1 proteinase inhibitor, a major tissue protectant against proteolytic enzymes released by activated neutrophils, facilitating the transendothelial migration of neutrophils to inflammatory sites. The encoded protein may also play a role in tumor invasion and metastasis through activation of MMP2. The gene has previously been referred to as MMP20 but has been renamed MMP25. [provided by RefSeq, Jul 2008]
Mouse(240047) matrix metallopeptidase 25
Rat(302963) matrix metallopeptidase 25
cow(531092) matrix metallopeptidase 25
domestic cat(101097941) matrix metallopeptidase 25
dog(490046) matrix metallopeptidase 25
naked mole-rat(101698825) matrix metallopeptidase 25
domestic guinea pig(100715085) matrix metallopeptidase 25
sheep(101120293) matrix metallopeptidase 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_139838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_139838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_139838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022468 Rosetta Predictions human pricing
NM_022718 Rosetta Predictions human pricing
XM_001055465 Rosetta Predictions rat pricing
XM_220199 Rosetta Predictions rat pricing
NM_001033339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355741 predicted 1497
2 SASI_Hs01_00117138 predicted 1175
3 SASI_Hs01_00117139 predicted 733
4 SASI_Hs01_00117141 predicted 1535
5 SASI_Hs01_00117142 predicted 692
6 SASI_Hs01_00117143 predicted 589
7 SASI_Hs01_00117140 predicted 682
8 SASI_Hs02_00355742 predicted 2117
9 SASI_Hs01_00117145 predicted 1824
10 SASI_Hs01_00117146 predicted 1648
11 SASI_Hs01_00117144 predicted 1472
12 SASI_Hs01_00117147 predicted 1647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198836 predicted 1182
2 SASI_Hs01_00198837 predicted 736
3 SASI_Hs01_00198838 predicted 689
4 SASI_Hs01_00198839 predicted 2200
5 SASI_Hs01_00198840 predicted 2292
6 SASI_Hs01_00198841 predicted 2353
7 SASI_Hs01_00198842 predicted 1542
8 SASI_Hs01_00198843 predicted 2198
9 SASI_Hs01_00198844 predicted 704
10 SASI_Hs01_00198845 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279621 predicted 1399
2 SASI_Rn02_00279622 predicted 965
3 SASI_Rn02_00279623 predicted 679
4 SASI_Rn02_00279624 predicted 1052
5 SASI_Rn02_00279625 predicted 1753
6 SASI_Rn02_00279626 predicted 538
7 SASI_Rn02_00279627 predicted 1777
8 SASI_Rn02_00279628 predicted 509
9 SASI_Rn02_00279629 predicted 817
10 SASI_Rn02_00279630 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122564 predicted 1108
2 SASI_Rn01_00122565 predicted 448
3 SASI_Rn01_00122566 predicted 492
4 SASI_Rn01_00122567 predicted 770
5 SASI_Rn01_00122568 predicted 930
6 SASI_Rn01_00122569 predicted 1243
7 SASI_Rn01_00122570 predicted 1305
8 SASI_Rn01_00122571 predicted 595
9 SASI_Rn01_00122572 predicted 384
10 SASI_Rn01_00122573 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117421 predicted 1074
2 SASI_Mm01_00117422 predicted 2045
3 SASI_Mm01_00117423 predicted 1316
4 SASI_Mm02_00288593 predicted 2166
5 SASI_Mm01_00117425 predicted 805
6 SASI_Mm01_00117426 predicted 1853
7 SASI_Mm01_00117428 predicted 1246
8 SASI_Mm01_00117429 predicted 1223
9 SASI_Mm01_00117430 predicted 753
10 SASI_Mm02_00288594 predicted 1265
11 SASI_Mm01_00117424 predicted 1050
12 SASI_Mm01_00117427 predicted 1850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022468
MMP25 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 25
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-1503s1c1
Sequence:CCGGGCCACAGAACGGGAAGACCTACTCGAGTAGGTCTTCCCGTTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-420s1c1
Sequence:CCGGCATCAAAGTCATGCAGAGGTTCTCGAGAACCTCTGCATGACTTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-1650s1c1
Sequence:CCGGCGCAGGTGACACCTACTTCTTCTCGAGAAGAAGTAGGTGTCACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-1178s1c1
Sequence:CCGGCTGATCGATGTGAGGGCAATTCTCGAGAATTGCCCTCACATCGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-739s1c1
Sequence:CCGGCCCGACATCCTCATCGACTTTCTCGAGAAAGTCGATGAGGATGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022468
MMP25 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 25
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-1503s1c1
Sequence:CCGGGCCACAGAACGGGAAGACCTACTCGAGTAGGTCTTCCCGTTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-420s1c1
Sequence:CCGGCATCAAAGTCATGCAGAGGTTCTCGAGAACCTCTGCATGACTTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-1650s1c1
Sequence:CCGGCGCAGGTGACACCTACTTCTTCTCGAGAAGAAGTAGGTGTCACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-1178s1c1
Sequence:CCGGCTGATCGATGTGAGGGCAATTCTCGAGAATTGCCCTCACATCGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-739s1c1
Sequence:CCGGCCCGACATCCTCATCGACTTTCTCGAGAAAGTCGATGAGGATGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022468
MMP25 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 25
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-1503s1c1
Sequence:CCGGGCCACAGAACGGGAAGACCTACTCGAGTAGGTCTTCCCGTTCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-420s1c1
Sequence:CCGGCATCAAAGTCATGCAGAGGTTCTCGAGAACCTCTGCATGACTTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-1650s1c1
Sequence:CCGGCGCAGGTGACACCTACTTCTTCTCGAGAAGAAGTAGGTGTCACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-1178s1c1
Sequence:CCGGCTGATCGATGTGAGGGCAATTCTCGAGAATTGCCCTCACATCGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022468.3-739s1c1
Sequence:CCGGCCCGACATCCTCATCGACTTTCTCGAGAAAGTCGATGAGGATGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_139838
MMP25 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 25
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-1079s1c1
Sequence:CCGGCCTGACATCATTATCCACTTTCTCGAGAAAGTGGATAATGATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-754s1c1
Sequence:CCGGGCAGGATGCAATCAAAGTCATCTCGAGATGACTTTGATTGCATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-1666s1c1
Sequence:CCGGGCCAACCCATGTGAAAGTCATCTCGAGATGACTTTCACATGGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-799s1c1
Sequence:CCGGGACTGGACAAATGGACCCAATCTCGAGATTGGGTCCATTTGTCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-1843s1c1
Sequence:CCGGGCCTCACAATGGCAAGACATACTCGAGTATGTCTTGCCATTGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_139838
MMP25 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 25
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-1079s1c1
Sequence:CCGGCCTGACATCATTATCCACTTTCTCGAGAAAGTGGATAATGATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-754s1c1
Sequence:CCGGGCAGGATGCAATCAAAGTCATCTCGAGATGACTTTGATTGCATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-1666s1c1
Sequence:CCGGGCCAACCCATGTGAAAGTCATCTCGAGATGACTTTCACATGGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-799s1c1
Sequence:CCGGGACTGGACAAATGGACCCAATCTCGAGATTGGGTCCATTTGTCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-1843s1c1
Sequence:CCGGGCCTCACAATGGCAAGACATACTCGAGTATGTCTTGCCATTGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_139838
MMP25 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 25
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-1079s1c1
Sequence:CCGGCCTGACATCATTATCCACTTTCTCGAGAAAGTGGATAATGATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-754s1c1
Sequence:CCGGGCAGGATGCAATCAAAGTCATCTCGAGATGACTTTGATTGCATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-1666s1c1
Sequence:CCGGGCCAACCCATGTGAAAGTCATCTCGAGATGACTTTCACATGGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-799s1c1
Sequence:CCGGGACTGGACAAATGGACCCAATCTCGAGATTGGGTCCATTTGTCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139838.2-1843s1c1
Sequence:CCGGGCCTCACAATGGCAAGACATACTCGAGTATGTCTTGCCATTGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)