EMAIL THIS PAGE TO A FRIEND

MMP27

matrix metallopeptidase 27

59 Gene Product Result for
Synonyms: MMP-27
UniProtKB ID: Q9H306, Q6UWK6
Gene ID:
Human(64066) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Mouse(234911) matrix metallopeptidase 27
Rat(300340) matrix metallopeptidase 27
chicken(395850) matrix metallopeptidase 27
domestic cat(101083699) matrix metallopeptidase 27
Horse(100068996) matrix metallopeptidase 27
cow(518487) matrix metallopeptidase 27
dog(489430) matrix metallopeptidase 27
sheep(101119416) matrix metallopeptidase 27
domestic guinea pig(100727410) matrix metallopeptidase 27
naked mole-rat(101698367) matrix metallopeptidase 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022122 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_134619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_134619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_134619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022122 Rosetta Predictions human pricing
NM_001106799 Rosetta Predictions rat pricing
NM_001030289 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355518 predicted 1183
2 SASI_Hs01_00142711 predicted 433
3 SASI_Hs01_00142713 predicted 483
4 SASI_Hs01_00142714 predicted 1087
5 SASI_Hs01_00142716 predicted 1339
6 SASI_Hs01_00142717 predicted 1390
7 SASI_Hs02_00355519 predicted 642
8 SASI_Hs01_00142718 predicted 1310
9 SASI_Hs01_00142719 predicted 1280
10 SASI_Hs01_00142720 predicted 1192
11 SASI_Hs01_00142712 predicted 234
12 SASI_Hs01_00142715 predicted 1101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222518 predicted 911
2 SASI_Rn02_00222519 predicted 1325
3 SASI_Rn02_00222520 predicted 411
4 SASI_Rn02_00222521 predicted 363
5 SASI_Rn02_00222522 predicted 1039
6 SASI_Rn02_00222523 predicted 492
7 SASI_Rn02_00222524 predicted 429
8 SASI_Rn02_00222525 predicted 441
9 SASI_Rn02_00222526 predicted 654
10 SASI_Rn02_00222527 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074612 predicted 1057
2 SASI_Mm01_00074613 predicted 365
3 SASI_Mm01_00074614 predicted 392
4 SASI_Mm01_00074615 predicted 630
5 SASI_Mm01_00074616 predicted 742
6 SASI_Mm01_00074617 predicted 1019
7 SASI_Mm01_00074618 predicted 1313
8 SASI_Mm01_00074619 predicted 855
9 SASI_Mm01_00074620 predicted 1308
10 SASI_Mm01_00074621 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022122
MMP27 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 27
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022122.2-927s21c1
Sequence:CCGGCACCTATGGAGGATCTATTATCTCGAGATAATAGATCCTCCATAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022122.2-1383s21c1
Sequence:CCGGACCCGAATCATGAGAACTAATCTCGAGATTAGTTCTCATGATTCGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022122.2-369s21c1
Sequence:CCGGATAAACTATACTCCGGATATGCTCGAGCATATCCGGAGTATAGTTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-120s1c1
Sequence:CCGGCCAGTTCTACTCTCTTGAAATCTCGAGATTTCAAGAGAGTAGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-1142s1c1
Sequence:CCGGCCGTCTGTGATAAGACCACAACTCGAGTTGTGGTCTTATCACAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-700s1c1
Sequence:CCGGGCCTTGATGTTCCCAAATTATCTCGAGATAATTTGGGAACATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-1321s1c1
Sequence:CCGGCGTGGATCAAAGCAATTTGAACTCGAGTTCAAATTGCTTTGATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-881s1c1
Sequence:CCGGGCAGAGAAGTAATGTTCTTTACTCGAGTAAAGAACATTACTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022122
MMP27 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 27
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022122.2-927s21c1
Sequence:CCGGCACCTATGGAGGATCTATTATCTCGAGATAATAGATCCTCCATAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022122.2-1383s21c1
Sequence:CCGGACCCGAATCATGAGAACTAATCTCGAGATTAGTTCTCATGATTCGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022122.2-369s21c1
Sequence:CCGGATAAACTATACTCCGGATATGCTCGAGCATATCCGGAGTATAGTTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-120s1c1
Sequence:CCGGCCAGTTCTACTCTCTTGAAATCTCGAGATTTCAAGAGAGTAGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-1142s1c1
Sequence:CCGGCCGTCTGTGATAAGACCACAACTCGAGTTGTGGTCTTATCACAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-700s1c1
Sequence:CCGGGCCTTGATGTTCCCAAATTATCTCGAGATAATTTGGGAACATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-1321s1c1
Sequence:CCGGCGTGGATCAAAGCAATTTGAACTCGAGTTCAAATTGCTTTGATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-881s1c1
Sequence:CCGGGCAGAGAAGTAATGTTCTTTACTCGAGTAAAGAACATTACTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022122
MMP27 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 27
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022122.2-927s21c1
Sequence:CCGGCACCTATGGAGGATCTATTATCTCGAGATAATAGATCCTCCATAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022122.2-1383s21c1
Sequence:CCGGACCCGAATCATGAGAACTAATCTCGAGATTAGTTCTCATGATTCGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022122.2-369s21c1
Sequence:CCGGATAAACTATACTCCGGATATGCTCGAGCATATCCGGAGTATAGTTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-120s1c1
Sequence:CCGGCCAGTTCTACTCTCTTGAAATCTCGAGATTTCAAGAGAGTAGAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-1142s1c1
Sequence:CCGGCCGTCTGTGATAAGACCACAACTCGAGTTGTGGTCTTATCACAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-700s1c1
Sequence:CCGGGCCTTGATGTTCCCAAATTATCTCGAGATAATTTGGGAACATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-1321s1c1
Sequence:CCGGCGTGGATCAAAGCAATTTGAACTCGAGTTCAAATTGCTTTGATCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022122.1-881s1c1
Sequence:CCGGGCAGAGAAGTAATGTTCTTTACTCGAGTAAAGAACATTACTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_134619
MMP27 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-998s1c1
Sequence:CCGGGCAGGGAAGTTATGTTCTTTACTCGAGTAAAGAACATAACTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-469s1c1
Sequence:CCGGCCACTGACGTTTACCAGGATACTCGAGTATCCTGGTAAACGTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-1224s1c1
Sequence:CCGGCGGATTTCCAAGACGTGTGAACTCGAGTTCACACGTCTTGGAAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-804s1c1
Sequence:CCGGCAATGATCAAACAGCCTTGATCTCGAGATCAAGGCTGTTTGATCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-141s1c1
Sequence:CCGGCCAGGCATATCTCAACCAGTTCTCGAGAACTGGTTGAGATATGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_134619
MMP27 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-998s1c1
Sequence:CCGGGCAGGGAAGTTATGTTCTTTACTCGAGTAAAGAACATAACTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-469s1c1
Sequence:CCGGCCACTGACGTTTACCAGGATACTCGAGTATCCTGGTAAACGTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-1224s1c1
Sequence:CCGGCGGATTTCCAAGACGTGTGAACTCGAGTTCACACGTCTTGGAAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-804s1c1
Sequence:CCGGCAATGATCAAACAGCCTTGATCTCGAGATCAAGGCTGTTTGATCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-141s1c1
Sequence:CCGGCCAGGCATATCTCAACCAGTTCTCGAGAACTGGTTGAGATATGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_134619
MMP27 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-998s1c1
Sequence:CCGGGCAGGGAAGTTATGTTCTTTACTCGAGTAAAGAACATAACTTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-469s1c1
Sequence:CCGGCCACTGACGTTTACCAGGATACTCGAGTATCCTGGTAAACGTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-1224s1c1
Sequence:CCGGCGGATTTCCAAGACGTGTGAACTCGAGTTCACACGTCTTGGAAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-804s1c1
Sequence:CCGGCAATGATCAAACAGCCTTGATCTCGAGATCAAGGCTGTTTGATCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_134619.4-141s1c1
Sequence:CCGGCCAGGCATATCTCAACCAGTTCTCGAGAACTGGTTGAGATATGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)