EMAIL THIS PAGE TO A FRIEND

MMP28

matrix metallopeptidase 28

89 Gene Product Result for
Synonyms: EPILYSIN MM28 MMP-28 MMP25
UniProtKB ID: Q9H239, Q96F04, Q96TE2
Gene ID:
Human(79148) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix for both normal physiological processes, such as embryonic development, reproduction and tissue remodeling, and disease processes, such as asthma and metastasis. This gene encodes a secreted enzyme that degrades casein. Its expression pattern suggests that it plays a role in tissue homeostasis and in wound repair. Transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
Mouse(118453) matrix metallopeptidase 28 (epilysin)
Rat(303384) matrix metallopeptidase 28
naked mole-rat(101711046) matrix metallopeptidase 28
Domestic Rabbit(100354466) matrix metallopeptidase 28
domestic guinea pig(100712646) matrix metallopeptidase 28
sheep(101112075) matrix metallopeptidase 28
chicken(417523) matrix metallopeptidase 28
Horse(100071568) matrix metallopeptidase 28
cow(519276) matrix metallopeptidase 28
dog(491136) matrix metallopeptidase 28
domestic cat(101085251) matrix metallopeptidase 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024302 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032278 Rosetta Predictions human pricing
NM_024302 Rosetta Predictions human pricing
NM_001079888 Rosetta Predictions rat pricing
NM_080453 Rosetta Predictions mouse pricing
NM_172797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024456 predicted 373
2 SASI_Hs01_00024457 predicted 415
3 SASI_Hs01_00024458 predicted 353
4 SASI_Hs01_00024459 predicted 415
5 SASI_Hs01_00024461 predicted 384
6 SASI_Hs01_00024462 predicted 340
7 SASI_Hs01_00024463 predicted 383
8 SASI_Hs01_00024464 predicted 380
9 SASI_Hs01_00024465 predicted 379
10 SASI_Hs02_00307861 predicted 384
11 SASI_Hs01_00024460 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103794 predicted 370
2 SASI_Hs01_00103795 predicted 410
3 SASI_Hs01_00103796 predicted 354
4 SASI_Hs01_00103797 predicted 415
5 SASI_Hs01_00103799 predicted 384
6 SASI_Hs01_00103800 predicted 337
7 SASI_Hs01_00103801 predicted 379
8 SASI_Hs01_00103802 predicted 377
9 SASI_Hs01_00103803 predicted 380
10 SASI_Hs02_00356645 predicted 387
11 SASI_Hs01_00103798 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208189 predicted 869
2 SASI_Rn02_00208190 predicted 887
3 SASI_Rn02_00208191 predicted 944
4 SASI_Rn02_00208192 predicted 640
5 SASI_Rn02_00208193 predicted 764
6 SASI_Rn02_00208194 predicted 472
7 SASI_Rn02_00208195 predicted 979
8 SASI_Rn02_00208196 predicted 955
9 SASI_Rn02_00208197 predicted 654
10 SASI_Rn02_00208198 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174903 predicted 865
2 SASI_Mm01_00174904 predicted 861
3 SASI_Mm01_00174905 predicted 1376
4 SASI_Mm01_00174906 predicted 1704
5 SASI_Mm01_00174907 predicted 579
6 SASI_Mm01_00174908 predicted 1744
7 SASI_Mm01_00174909 predicted 1774
8 SASI_Mm01_00174910 predicted 265
9 SASI_Mm02_00338109 predicted 479
10 SASI_Mm01_00174912 predicted 1362
11 SASI_Mm01_00174911 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068133 predicted 871
2 SASI_Mm01_00068134 predicted 862
3 SASI_Mm01_00068135 predicted 1336
4 SASI_Mm01_00068136 predicted 1656
5 SASI_Mm01_00068137 predicted 580
6 SASI_Mm01_00068138 predicted 1693
7 SASI_Mm01_00068139 predicted 1734
8 SASI_Mm01_00068140 predicted 265
9 SASI_Mm02_00344704 predicted 479
10 SASI_Mm01_00068142 predicted 1322
11 SASI_Mm01_00068141 predicted 1797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024302
MMP28 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 28
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-650s1c1
Sequence:CCGGGCAAGGTAACAAATGGTACAACTCGAGTTGTACCATTTGTTACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-1401s1c1
Sequence:CCGGGCGGCAGTGTCATTGAATGATCTCGAGATCATTCAATGACACTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-1701s1c1
Sequence:CCGGTCCATCATCTTCTTCCGAGATCTCGAGATCTCGGAAGAAGATGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-387s1c1
Sequence:CCGGGCATTCCTAGAGAAGTACGGACTCGAGTCCGTACTTCTCTAGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-629s1c1
Sequence:CCGGGCGTAAGAAACGCTTTGCAAACTCGAGTTTGCAAAGCGTTTCTTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024302.3-1263s21c1
Sequence:CCGGGGCAACAGCAACTGTACATTTCTCGAGAAATGTACAGTTGCTGTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024302.3-1206s21c1
Sequence:CCGGCTGAAACGCAGGGCCCTAAATCTCGAGATTTAGGGCCCTGCGTTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024302.3-2104s21c1
Sequence:CCGGGCCTTTGTTTCTTCGGCTAAACTCGAGTTTAGCCGAAGAAACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024302
MMP28 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 28
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-650s1c1
Sequence:CCGGGCAAGGTAACAAATGGTACAACTCGAGTTGTACCATTTGTTACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-1401s1c1
Sequence:CCGGGCGGCAGTGTCATTGAATGATCTCGAGATCATTCAATGACACTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-1701s1c1
Sequence:CCGGTCCATCATCTTCTTCCGAGATCTCGAGATCTCGGAAGAAGATGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-387s1c1
Sequence:CCGGGCATTCCTAGAGAAGTACGGACTCGAGTCCGTACTTCTCTAGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-629s1c1
Sequence:CCGGGCGTAAGAAACGCTTTGCAAACTCGAGTTTGCAAAGCGTTTCTTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024302.3-1263s21c1
Sequence:CCGGGGCAACAGCAACTGTACATTTCTCGAGAAATGTACAGTTGCTGTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024302.3-1206s21c1
Sequence:CCGGCTGAAACGCAGGGCCCTAAATCTCGAGATTTAGGGCCCTGCGTTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024302.3-2104s21c1
Sequence:CCGGGCCTTTGTTTCTTCGGCTAAACTCGAGTTTAGCCGAAGAAACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024302
MMP28 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 28
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-650s1c1
Sequence:CCGGGCAAGGTAACAAATGGTACAACTCGAGTTGTACCATTTGTTACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-1401s1c1
Sequence:CCGGGCGGCAGTGTCATTGAATGATCTCGAGATCATTCAATGACACTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-1701s1c1
Sequence:CCGGTCCATCATCTTCTTCCGAGATCTCGAGATCTCGGAAGAAGATGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-387s1c1
Sequence:CCGGGCATTCCTAGAGAAGTACGGACTCGAGTCCGTACTTCTCTAGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024302.2-629s1c1
Sequence:CCGGGCGTAAGAAACGCTTTGCAAACTCGAGTTTGCAAAGCGTTTCTTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024302.3-1263s21c1
Sequence:CCGGGGCAACAGCAACTGTACATTTCTCGAGAAATGTACAGTTGCTGTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024302.3-1206s21c1
Sequence:CCGGCTGAAACGCAGGGCCCTAAATCTCGAGATTTAGGGCCCTGCGTTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024302.3-2104s21c1
Sequence:CCGGGCCTTTGTTTCTTCGGCTAAACTCGAGTTTAGCCGAAGAAACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080453
MMP28 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-1050s1c1
Sequence:CCGGCGGAAACCAGAGGTCCTAAATCTCGAGATTTAGGACCTCTGGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-1219s1c1
Sequence:CCGGTGGAGACTTCTACTTCTTTAACTCGAGTTAAAGAAGTAGAAGTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-478s1c1
Sequence:CCGGGCCAGGTAACAAATGGTACAACTCGAGTTGTACCATTTGTTACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-289s1c1
Sequence:CCGGCATCAGAGAGTTCCAGTGGATCTCGAGATCCACTGGAACTCTCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-1520s1c1
Sequence:CCGGGACCACTATTGGCATTTGGATCTCGAGATCCAAATGCCAATAGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080453
MMP28 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-1050s1c1
Sequence:CCGGCGGAAACCAGAGGTCCTAAATCTCGAGATTTAGGACCTCTGGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-1219s1c1
Sequence:CCGGTGGAGACTTCTACTTCTTTAACTCGAGTTAAAGAAGTAGAAGTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-478s1c1
Sequence:CCGGGCCAGGTAACAAATGGTACAACTCGAGTTGTACCATTTGTTACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-289s1c1
Sequence:CCGGCATCAGAGAGTTCCAGTGGATCTCGAGATCCACTGGAACTCTCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-1520s1c1
Sequence:CCGGGACCACTATTGGCATTTGGATCTCGAGATCCAAATGCCAATAGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080453
MMP28 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-1050s1c1
Sequence:CCGGCGGAAACCAGAGGTCCTAAATCTCGAGATTTAGGACCTCTGGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-1219s1c1
Sequence:CCGGTGGAGACTTCTACTTCTTTAACTCGAGTTAAAGAAGTAGAAGTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-478s1c1
Sequence:CCGGGCCAGGTAACAAATGGTACAACTCGAGTTGTACCATTTGTTACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-289s1c1
Sequence:CCGGCATCAGAGAGTTCCAGTGGATCTCGAGATCCACTGGAACTCTCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080453.1-1520s1c1
Sequence:CCGGGACCACTATTGGCATTTGGATCTCGAGATCCAAATGCCAATAGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)