EMAIL THIS PAGE TO A FRIEND

MMP2

matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)

152 Gene Product Result for
Synonyms: CLG4 CLG4A MMP-II MONA TBE-1
UniProtKB ID: P08253, B2R6U1, B4DWH3, E9PE45, Q9UCJ8
Gene ID:
Human(4313) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. This gene encodes an enzyme which degrades type IV collagen, the major structural component of basement membranes. The enzyme plays a role in endometrial menstrual breakdown, regulation of vascularization and the inflammatory response. Mutations in this gene have been associated with Winchester syndrome and Nodulosis-Arthropathy-Osteolysis (NAO) syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(17390) matrix metallopeptidase 2
Rat(81686) matrix metallopeptidase 2
domestic guinea pig(100719361) matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Domestic Rabbit(100009000) matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
naked mole-rat(101696977) matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
sheep(443115) matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Zebrafish(337179) matrix metalloproteinase 2
chicken(386583) matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
fruit fly(35997) Matrix metalloproteinase 2
cow(282872) matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Horse(100033948) matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
domestic cat(101098838) matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
dog(403733) matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
F8755 Fenbufen analytical standard human pricing
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0093 AQUA Peptide TYIFAGD[K] cow, dog, human, mouse, pig, rat, sheep pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004530 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127891 Rosetta Predictions human pricing
NM_004530 Rosetta Predictions human pricing
NM_031054 Rosetta Predictions rat pricing
NM_008610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330404 predicted 2051
2 SASI_Hs02_00330405 predicted 1759
3 SASI_Hs02_00330406 predicted 1428
4 SASI_Hs02_00330407 predicted 1634
5 SASI_Hs02_00330408 predicted 1891
6 SASI_Hs02_00330409 predicted 1170
7 SASI_Hs02_00330410 predicted 1915
8 SASI_Hs02_00330411 predicted 2091
9 SASI_Hs02_00330412 predicted 1766
10 SASI_Hs02_00330413 predicted 1565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198360 predicted 2414
2 SASI_Hs01_00198361 predicted 2124
3 SASI_Hs01_00198362 predicted 1786
4 SASI_Hs01_00198364 predicted 740
5 SASI_Hs01_00198365 predicted 1997
6 SASI_Hs01_00198366 predicted 2262
7 SASI_Hs02_00337827 predicted 956
8 SASI_Hs01_00198367 predicted 2279
9 SASI_Hs01_00198368 predicted 2115
10 SASI_Hs02_00337828 predicted 2458
11 SASI_Hs01_00198359 predicted 808
12 SASI_Hs01_00198363 predicted 2056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264281 predicted 2062
2 SASI_Rn01_00118920 predicted 1551
3 SASI_Rn02_00264282 predicted 2052
4 SASI_Rn02_00264283 predicted 1162
5 SASI_Rn01_00118923 predicted 1897
6 SASI_Rn02_00264284 predicted 2235
7 SASI_Rn02_00264285 predicted 999
8 SASI_Rn02_00264286 predicted 739
9 SASI_Rn01_00118919 predicted 2047
10 SASI_Rn01_00118918 predicted 2235
11 SASI_Rn01_00118916 predicted 1343
12 SASI_Rn01_00118917 predicted 1435
13 SASI_Rn01_00118921 predicted 2219
14 SASI_Rn01_00118922 predicted 1135
15 SASI_Rn01_00118924 predicted 1452
16 SASI_Rn01_00118925 predicted 2414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105812 predicted 1923
2 SASI_Mm01_00105813 predicted 1563
3 SASI_Mm01_00105814 predicted 2242
4 SASI_Mm02_00314284 predicted 1891
5 SASI_Mm01_00105815 predicted 898
6 SASI_Mm01_00105816 predicted 2052
7 SASI_Mm01_00105817 predicted 1907
8 SASI_Mm01_00105818 predicted 2037
9 SASI_Mm01_00105819 predicted 1162
10 SASI_Mm01_00105820 predicted 960
11 SASI_Mm01_00105821 predicted 2230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008610
MMP2 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-1015s1c1
Sequence:CCGGCCGGGATAAGAAATATGGATTCTCGAGAATCCATATTTCTTATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-1643s1c1
Sequence:CCGGGCTGTGTTCTTCGCAGGGAATCTCGAGATTCCCTGCGAAGAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-196s1c1
Sequence:CCGGGCAATACCTGAATACTTTCTACTCGAGTAGAAAGTATTCAGGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-1924s1c1
Sequence:CCGGCGGTGGTCATAGCTACTTCTTCTCGAGAAGAAGTAGCTATGACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-250s1c1
Sequence:CCGGGCTGAAAGATACCCTCAAGAACTCGAGTTCTTGAGGGTATCTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008610
MMP2 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-1015s1c1
Sequence:CCGGCCGGGATAAGAAATATGGATTCTCGAGAATCCATATTTCTTATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-1643s1c1
Sequence:CCGGGCTGTGTTCTTCGCAGGGAATCTCGAGATTCCCTGCGAAGAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-196s1c1
Sequence:CCGGGCAATACCTGAATACTTTCTACTCGAGTAGAAAGTATTCAGGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-1924s1c1
Sequence:CCGGCGGTGGTCATAGCTACTTCTTCTCGAGAAGAAGTAGCTATGACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-250s1c1
Sequence:CCGGGCTGAAAGATACCCTCAAGAACTCGAGTTCTTGAGGGTATCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008610
MMP2 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-1015s1c1
Sequence:CCGGCCGGGATAAGAAATATGGATTCTCGAGAATCCATATTTCTTATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-1643s1c1
Sequence:CCGGGCTGTGTTCTTCGCAGGGAATCTCGAGATTCCCTGCGAAGAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-196s1c1
Sequence:CCGGGCAATACCTGAATACTTTCTACTCGAGTAGAAAGTATTCAGGTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-1924s1c1
Sequence:CCGGCGGTGGTCATAGCTACTTCTTCTCGAGAAGAAGTAGCTATGACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008610.1-250s1c1
Sequence:CCGGGCTGAAAGATACCCTCAAGAACTCGAGTTCTTGAGGGTATCTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004530
MMP2 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-496s1c1
Sequence:CCGGGCTGAAGGACACACTAAAGAACTCGAGTTCTTTAGTGTGTCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-1997s1c1
Sequence:CCGGGCCGCCTTTAACTGGAGCAAACTCGAGTTTGCTCCAGTTAAAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-2215s1c1
Sequence:CCGGCCAAAGTCTGAAGAGCGTGAACTCGAGTTCACGCTCTTCAGACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-1905s21c1
Sequence:CCGGGCTGTGTTCTTTGCAGGGAATCTCGAGATTCCCTGCAAAGAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-2237s21c1
Sequence:CCGGCCAAAGTCTGAAGAGCGTGAACTCGAGTTCACGCTCTTCAGACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-1883s1c1
Sequence:CCGGGCTGTGTTCTTTGCAGGGAATCTCGAGATTCCCTGCAAAGAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-788s1c1
Sequence:CCGGGCAGACATCATGATCAACTTTCTCGAGAAAGTTGATCATGATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-2019s21c1
Sequence:CCGGGCCGCCTTTAACTGGAGCAAACTCGAGTTTGCTCCAGTTAAAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-810s21c1
Sequence:CCGGGCAGACATCATGATCAACTTTCTCGAGAAAGTTGATCATGATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004530
MMP2 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-496s1c1
Sequence:CCGGGCTGAAGGACACACTAAAGAACTCGAGTTCTTTAGTGTGTCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-1997s1c1
Sequence:CCGGGCCGCCTTTAACTGGAGCAAACTCGAGTTTGCTCCAGTTAAAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-2215s1c1
Sequence:CCGGCCAAAGTCTGAAGAGCGTGAACTCGAGTTCACGCTCTTCAGACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-1905s21c1
Sequence:CCGGGCTGTGTTCTTTGCAGGGAATCTCGAGATTCCCTGCAAAGAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-2237s21c1
Sequence:CCGGCCAAAGTCTGAAGAGCGTGAACTCGAGTTCACGCTCTTCAGACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-1883s1c1
Sequence:CCGGGCTGTGTTCTTTGCAGGGAATCTCGAGATTCCCTGCAAAGAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-788s1c1
Sequence:CCGGGCAGACATCATGATCAACTTTCTCGAGAAAGTTGATCATGATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-2019s21c1
Sequence:CCGGGCCGCCTTTAACTGGAGCAAACTCGAGTTTGCTCCAGTTAAAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-810s21c1
Sequence:CCGGGCAGACATCATGATCAACTTTCTCGAGAAAGTTGATCATGATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004530
MMP2 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-496s1c1
Sequence:CCGGGCTGAAGGACACACTAAAGAACTCGAGTTCTTTAGTGTGTCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-1997s1c1
Sequence:CCGGGCCGCCTTTAACTGGAGCAAACTCGAGTTTGCTCCAGTTAAAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-2215s1c1
Sequence:CCGGCCAAAGTCTGAAGAGCGTGAACTCGAGTTCACGCTCTTCAGACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-1905s21c1
Sequence:CCGGGCTGTGTTCTTTGCAGGGAATCTCGAGATTCCCTGCAAAGAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-2237s21c1
Sequence:CCGGCCAAAGTCTGAAGAGCGTGAACTCGAGTTCACGCTCTTCAGACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-1883s1c1
Sequence:CCGGGCTGTGTTCTTTGCAGGGAATCTCGAGATTCCCTGCAAAGAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004530.1-788s1c1
Sequence:CCGGGCAGACATCATGATCAACTTTCTCGAGAAAGTTGATCATGATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-2019s21c1
Sequence:CCGGGCCGCCTTTAACTGGAGCAAACTCGAGTTTGCTCCAGTTAAAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004530.4-810s21c1
Sequence:CCGGGCAGACATCATGATCAACTTTCTCGAGAAAGTTGATCATGATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)