EMAIL THIS PAGE TO A FRIEND

MMP3

matrix metallopeptidase 3 (stromelysin 1, progelatinase)

93 Gene Product Result for
Synonyms: CHDS6 MMP-3 SL-1 STMY STMY1 STR1
UniProtKB ID: P08254, B2R8B8, Q3B7S0, Q6GRF8
Gene ID:
Human(4314) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. This gene encodes an enzyme which degrades fibronectin, laminin, collagens III, IV, IX, and X, and cartilage proteoglycans. The enzyme is thought to be involved in wound repair, progression of atherosclerosis, and tumor initiation. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008]
Mouse(17392) matrix metallopeptidase 3
Rat(171045) matrix metallopeptidase 3
cow(281309) matrix metallopeptidase 3 (stromelysin 1, progelatinase)
Horse(100034195) matrix metallopeptidase 3 (stromelysin 1, progelatinase)
domestic cat(493666) matrix metallopeptidase 3 (stromelysin 1, progelatinase)
dog(403445) matrix metallopeptidase 3 (stromelysin 1, progelatinase)
domestic cat(101081492) matrix metallopeptidase 3 (stromelysin 1, progelatinase)
sheep(101118895) matrix metallopeptidase 3 (stromelysin 1, progelatinase)
domestic guinea pig(100729101) matrix metallopeptidase 3 (stromelysin 1, progelatinase)
Domestic Rabbit(100009111) matrix metallopeptidase 3 (stromelysin 1, progelatinase)
naked mole-rat(101716622) matrix metallopeptidase 3 (stromelysin 1, progelatinase)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M6053 Anti-Matrix Metalloproteinase-3, Propeptide Region antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
SAB4501892 Anti-MMP-3 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB2502113 Anti-MMP3 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4501893 Anti-MMP3 (Cleaved-Phe100) antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB1406132 Anti-MMP3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108287 Anti-MMP3 antibody produced in rabbit affinity isolated antibody human, mouse, dog
immunohistochemistry, western blot pricing
HPA007875 Anti-MMP3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
M6552 Monoclonal Anti-Matrix Metalloproteinase-3 antibody produced in mouse clone SL-1 IIIC4, purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5300422 Monoclonal Anti-MMP3 antibody produced in mouse clone 4F10, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, western blot pricing
SAB1402273 Monoclonal Anti-MMP3 antibody produced in mouse clone 4C11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP) pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
M9420 7-Methoxycoumarin-4-acetyl-Arg-Pro-Lys-Pro-Tyr-Ala-Nva-Trp-Met-(2,4-dinitrophenyl)Lys amide ≥97% (HPLC) human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0135 AQUA Peptide GEILI[F]K human pricing
AQ0134 AQUA Peptide IVNYTPDLP[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002422 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002422 Rosetta Predictions human pricing
NM_133523 Rosetta Predictions rat pricing
NM_010809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060839 predicted 1516
2 SASI_Hs01_00060840 predicted 1090
3 SASI_Hs01_00060841 predicted 665
4 SASI_Hs01_00060842 predicted 1257
5 SASI_Hs01_00060843 predicted 633
6 SASI_Hs01_00060844 predicted 203
7 SASI_Hs01_00060845 predicted 1334
8 SASI_Hs01_00060846 predicted 679
9 SASI_Hs01_00060848 predicted 1510
10 SASI_Hs02_00333816 predicted 1133
11 SASI_Hs01_00060847 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090117 predicted 1208
2 SASI_Rn01_00090118 predicted 1361
3 SASI_Rn02_00267704 predicted 958
4 SASI_Rn02_00267705 predicted 907
5 SASI_Rn01_00090119 predicted 1519
6 SASI_Rn01_00090120 predicted 1435
7 SASI_Rn01_00090121 predicted 1074
8 SASI_Rn01_00090123 predicted 298
9 SASI_Rn01_00090124 predicted 1532
10 SASI_Rn01_00090126 predicted 572
11 SASI_Rn01_00090122 predicted 888
12 SASI_Rn01_00090125 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198308 predicted 642
2 SASI_Mm01_00198309 predicted 1232
3 SASI_Mm01_00198310 predicted 1394
4 SASI_Mm01_00198311 predicted 1445
5 SASI_Mm01_00198312 predicted 910
6 SASI_Mm01_00198314 predicted 1148
7 SASI_Mm01_00198315 predicted 1551
8 SASI_Mm01_00198316 predicted 662
9 SASI_Mm01_00198317 predicted 1234
10 SASI_Mm02_00319399 predicted 1436
11 SASI_Mm01_00198313 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002422
VALIDATED
MMP3 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 3 (stromelysin 1, progelatinase)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002422.3-1474s21c1
Sequence:CCGGAGAGTAACAGCTGGCTTAATTCTCGAGAATTAAGCCAGCTGTTACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002422.3-637s21c1
Sequence:CCGGTTAATGGAGATGCCCACTTTGCTCGAGCAAAGTGGGCATCTCCATTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-775s1c1
Sequence:CCGGCCACTCTATCACTCACTCACACTCGAGTGTGAGTGAGTGATAGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002422.x-1157s1c1
Sequence:CCGGGAAATGAGGTACGAGCTGGATCTCGAGATCCAGCTCGTACCTCATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-1512s1c1
Sequence:CCGGAGGCACAATATGGGCACTTTACTCGAGTAAAGTGCCCATATTGTGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-657s1c1
Sequence:CCGGTGATGATGAACAATGGACAAACTCGAGTTTGTCCATTGTTCATCATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-677s1c1
Sequence:CCGGAGGATACAACAGGGACCAATTCTCGAGAATTGGTCCCTGTTGTATCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002422
VALIDATED
MMP3 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 3 (stromelysin 1, progelatinase)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002422.3-1474s21c1
Sequence:CCGGAGAGTAACAGCTGGCTTAATTCTCGAGAATTAAGCCAGCTGTTACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002422.3-637s21c1
Sequence:CCGGTTAATGGAGATGCCCACTTTGCTCGAGCAAAGTGGGCATCTCCATTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-775s1c1
Sequence:CCGGCCACTCTATCACTCACTCACACTCGAGTGTGAGTGAGTGATAGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002422.x-1157s1c1
Sequence:CCGGGAAATGAGGTACGAGCTGGATCTCGAGATCCAGCTCGTACCTCATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-1512s1c1
Sequence:CCGGAGGCACAATATGGGCACTTTACTCGAGTAAAGTGCCCATATTGTGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-657s1c1
Sequence:CCGGTGATGATGAACAATGGACAAACTCGAGTTTGTCCATTGTTCATCATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-677s1c1
Sequence:CCGGAGGATACAACAGGGACCAATTCTCGAGAATTGGTCCCTGTTGTATCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002422
VALIDATED
MMP3 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 3 (stromelysin 1, progelatinase)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002422.3-1474s21c1
Sequence:CCGGAGAGTAACAGCTGGCTTAATTCTCGAGAATTAAGCCAGCTGTTACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002422.3-637s21c1
Sequence:CCGGTTAATGGAGATGCCCACTTTGCTCGAGCAAAGTGGGCATCTCCATTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-775s1c1
Sequence:CCGGCCACTCTATCACTCACTCACACTCGAGTGTGAGTGAGTGATAGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002422.x-1157s1c1
Sequence:CCGGGAAATGAGGTACGAGCTGGATCTCGAGATCCAGCTCGTACCTCATTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-1512s1c1
Sequence:CCGGAGGCACAATATGGGCACTTTACTCGAGTAAAGTGCCCATATTGTGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-657s1c1
Sequence:CCGGTGATGATGAACAATGGACAAACTCGAGTTTGTCCATTGTTCATCATCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002422.x-677s1c1
Sequence:CCGGAGGATACAACAGGGACCAATTCTCGAGAATTGGTCCCTGTTGTATCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010809
VALIDATED
MMP3 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 3 (stromelysin 1, progelatinase)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010809.1-1615s21c1
Sequence:CCGGGCAGAACCAAACAGGAGCTATCTCGAGATAGCTCCTGTTTGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010809.1-1479s21c1
Sequence:CCGGCCCACATATTGAAGAGCAATACTCGAGTATTGCTCTTCAATATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010809.1-1445s21c1
Sequence:CCGGCAGTTGGAATTTGACCCAAATCTCGAGATTTGGGTCAAATTCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010809.1-1184s21c1
Sequence:CCGGGAGCTAGCAGGTTATCCTAAACTCGAGTTTAGGATAACCTGCTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010809.1-1615s1c1
Sequence:CCGGGCAGAACCAAACAGGAGCTATCTCGAGATAGCTCCTGTTTGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010809.1-1479s1c1
Sequence:CCGGCCCACATATTGAAGAGCAATACTCGAGTATTGCTCTTCAATATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010809.1-839s1c1
Sequence:CCGGCAAGATGATGTAGATGGTATTCTCGAGAATACCATCTACATCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010809.1-1444s1c1
Sequence:CCGGGCAGTTGGAATTTGACCCAAACTCGAGTTTGGGTCAAATTCCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010809
VALIDATED
MMP3 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 3 (stromelysin 1, progelatinase)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010809.1-1615s21c1
Sequence:CCGGGCAGAACCAAACAGGAGCTATCTCGAGATAGCTCCTGTTTGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010809.1-1479s21c1
Sequence:CCGGCCCACATATTGAAGAGCAATACTCGAGTATTGCTCTTCAATATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010809.1-1445s21c1
Sequence:CCGGCAGTTGGAATTTGACCCAAATCTCGAGATTTGGGTCAAATTCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010809.1-1184s21c1
Sequence:CCGGGAGCTAGCAGGTTATCCTAAACTCGAGTTTAGGATAACCTGCTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010809.1-1615s1c1
Sequence:CCGGGCAGAACCAAACAGGAGCTATCTCGAGATAGCTCCTGTTTGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010809.1-1479s1c1
Sequence:CCGGCCCACATATTGAAGAGCAATACTCGAGTATTGCTCTTCAATATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010809.1-839s1c1
Sequence:CCGGCAAGATGATGTAGATGGTATTCTCGAGAATACCATCTACATCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010809.1-1444s1c1
Sequence:CCGGGCAGTTGGAATTTGACCCAAACTCGAGTTTGGGTCAAATTCCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010809
VALIDATED
MMP3 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 3 (stromelysin 1, progelatinase)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010809.1-1615s21c1
Sequence:CCGGGCAGAACCAAACAGGAGCTATCTCGAGATAGCTCCTGTTTGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010809.1-1479s21c1
Sequence:CCGGCCCACATATTGAAGAGCAATACTCGAGTATTGCTCTTCAATATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010809.1-1445s21c1
Sequence:CCGGCAGTTGGAATTTGACCCAAATCTCGAGATTTGGGTCAAATTCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_010809.1-1184s21c1
Sequence:CCGGGAGCTAGCAGGTTATCCTAAACTCGAGTTTAGGATAACCTGCTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010809.1-1615s1c1
Sequence:CCGGGCAGAACCAAACAGGAGCTATCTCGAGATAGCTCCTGTTTGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010809.1-1479s1c1
Sequence:CCGGCCCACATATTGAAGAGCAATACTCGAGTATTGCTCTTCAATATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010809.1-839s1c1
Sequence:CCGGCAAGATGATGTAGATGGTATTCTCGAGAATACCATCTACATCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010809.1-1444s1c1
Sequence:CCGGGCAGTTGGAATTTGACCCAAACTCGAGTTTGGGTCAAATTCCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)