EMAIL THIS PAGE TO A FRIEND

MMP7

matrix metallopeptidase 7 (matrilysin, uterine)

86 Gene Product Result for
Synonyms: MMP-7 MPSL1 PUMP-1
UniProtKB ID: P09237, Q9BTK9
Gene ID:
Human(4316) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The enzyme encoded by this gene degrades proteoglycans, fibronectin, elastin and casein and differs from most MMP family members in that it lacks a conserved C-terminal protein domain. The enzyme is involved in wound healing, and studies in mice suggest that it regulates the activity of defensins in intestinal mucosa. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008]
Mouse(17393) matrix metallopeptidase 7
Rat(25335) matrix metallopeptidase 7
chicken(418983) matrix metallopeptidase 7 (matrilysin, uterine)
dog(489432) matrix metallopeptidase 7 (matrilysin, uterine)
cow(286794) matrix metallopeptidase 7 (matrilysin, uterine)
naked mole-rat(101718114) matrix metallopeptidase 7 (matrilysin, uterine)
domestic guinea pig(100727130) matrix metallopeptidase 7 (matrilysin, uterine)
sheep(100192317) matrix metallopeptidase 7 (matrilysin, uterine)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB0369 Human MMP-7 ELISA Kit on for cell culture supernatant human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002423 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028021 MISSION® esiRNA esiRNA human MMP7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002423 Rosetta Predictions human pricing
NM_012864 Rosetta Predictions rat pricing
NM_010810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056547 predicted 692
2 SASI_Hs01_00056548 predicted 217
3 SASI_Hs01_00056549 predicted 638
4 SASI_Hs01_00056550 predicted 269
5 SASI_Hs01_00056551 predicted 323
6 SASI_Hs01_00056552 predicted 249
7 SASI_Hs01_00056553 predicted 838
8 SASI_Hs01_00056554 predicted 615
9 SASI_Hs02_00333817 predicted 279
10 SASI_Hs02_00333818 predicted 714
11 SASI_Hs01_00056545 predicted 554
12 SASI_Hs01_00056546 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035665 predicted 441
2 SASI_Rn01_00035666 predicted 523
3 SASI_Rn01_00035667 predicted 647
4 SASI_Rn01_00035668 predicted 772
5 SASI_Rn01_00035669 predicted 250
6 SASI_Rn01_00035670 predicted 321
7 SASI_Rn01_00035672 predicted 420
8 SASI_Rn01_00035673 predicted 436
9 SASI_Rn01_00035674 predicted 732
10 SASI_Rn02_00260349 predicted 711
11 SASI_Rn01_00035671 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130940 predicted 345
2 SASI_Mm02_00319400 predicted 275
3 SASI_Mm02_00319401 predicted 376
4 SASI_Mm02_00319402 predicted 437
5 SASI_Mm02_00319403 predicted 411
6 SASI_Mm01_00130944 predicted 428
7 SASI_Mm02_00319404 predicted 614
8 SASI_Mm02_00319405 predicted 488
9 SASI_Mm02_00319406 predicted 530
10 SASI_Mm02_00319407 predicted 434
11 SASI_Mm01_00130941 predicted 792
12 SASI_Mm01_00130942 predicted 746
13 SASI_Mm01_00130943 predicted 749
14 SASI_Mm01_00130945 predicted 478
15 SASI_Mm01_00130946 predicted 648
16 SASI_Mm01_00130947 predicted 784
17 SASI_Mm01_00130948 predicted 339
18 SASI_Mm01_00130949 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010810
MMP7 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 7 (matrilysin, uterine)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-378s1c1
Sequence:CCGGCCTACAGAATTGTATCCTATACTCGAGTATAGGATACAATTCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-803s1c1
Sequence:CCGGGCAGGCATTCAGAAGTTATATCTCGAGATATAACTTCTGAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-748s1c1
Sequence:CCGGCCCTACCTATCAAAGAGACTACTCGAGTAGTCTCTTTGATAGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-280s1c1
Sequence:CCGGCATCATGGAAATAATGCAGAACTCGAGTTCTGCATTATTTCCATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-470s1c1
Sequence:CCGGCCACTGAACTTCAAGAGGGTTCTCGAGAACCCTCTTGAAGTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010810
MMP7 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 7 (matrilysin, uterine)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-378s1c1
Sequence:CCGGCCTACAGAATTGTATCCTATACTCGAGTATAGGATACAATTCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-803s1c1
Sequence:CCGGGCAGGCATTCAGAAGTTATATCTCGAGATATAACTTCTGAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-748s1c1
Sequence:CCGGCCCTACCTATCAAAGAGACTACTCGAGTAGTCTCTTTGATAGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-280s1c1
Sequence:CCGGCATCATGGAAATAATGCAGAACTCGAGTTCTGCATTATTTCCATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-470s1c1
Sequence:CCGGCCACTGAACTTCAAGAGGGTTCTCGAGAACCCTCTTGAAGTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010810
MMP7 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 7 (matrilysin, uterine)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-378s1c1
Sequence:CCGGCCTACAGAATTGTATCCTATACTCGAGTATAGGATACAATTCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-803s1c1
Sequence:CCGGGCAGGCATTCAGAAGTTATATCTCGAGATATAACTTCTGAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-748s1c1
Sequence:CCGGCCCTACCTATCAAAGAGACTACTCGAGTAGTCTCTTTGATAGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-280s1c1
Sequence:CCGGCATCATGGAAATAATGCAGAACTCGAGTTCTGCATTATTTCCATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010810.1-470s1c1
Sequence:CCGGCCACTGAACTTCAAGAGGGTTCTCGAGAACCCTCTTGAAGTTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002423
VALIDATED
MMP7 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 7 (matrilysin, uterine)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002423.2-248s1c1
Sequence:CCGGCCTACCTATAACTGGAATGTTCTCGAGAACATTCCAGTTATAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-935s21c1
Sequence:CCGGCCACTCCATTTAGCAATTATGCTCGAGCATAATTGCTAAATGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002423.2-278s1c1
Sequence:CCGGCGTCATAGAAATAATGCAGAACTCGAGTTCTGCATTATTTCTATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002423.2-409s1c1
Sequence:CCGGCGCATATTACAGTGGATCGATCTCGAGATCGATCCACTGTAATATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002423.2-386s1c1
Sequence:CCGGCGTATCATATACTCGAGACTTCTCGAGAAGTCTCGAGTATATGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002423.2-788s1c1
Sequence:CCGGCCAGGATGATATTAAAGGCATCTCGAGATGCCTTTAATATCATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-386s21c1
Sequence:CCGGCGTATCATATACTCGAGACTTCTCGAGAAGTCTCGAGTATATGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-278s21c1
Sequence:CCGGCGTCATAGAAATAATGCAGAACTCGAGTTCTGCATTATTTCTATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-248s21c1
Sequence:CCGGCCTACCTATAACTGGAATGTTCTCGAGAACATTCCAGTTATAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-322s21c1
Sequence:CCGGTTGCAGAATACTCACTATTTCCTCGAGGAAATAGTGAGTATTCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002423
VALIDATED
MMP7 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 7 (matrilysin, uterine)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002423.2-248s1c1
Sequence:CCGGCCTACCTATAACTGGAATGTTCTCGAGAACATTCCAGTTATAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-935s21c1
Sequence:CCGGCCACTCCATTTAGCAATTATGCTCGAGCATAATTGCTAAATGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002423.2-278s1c1
Sequence:CCGGCGTCATAGAAATAATGCAGAACTCGAGTTCTGCATTATTTCTATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002423.2-409s1c1
Sequence:CCGGCGCATATTACAGTGGATCGATCTCGAGATCGATCCACTGTAATATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002423.2-386s1c1
Sequence:CCGGCGTATCATATACTCGAGACTTCTCGAGAAGTCTCGAGTATATGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002423.2-788s1c1
Sequence:CCGGCCAGGATGATATTAAAGGCATCTCGAGATGCCTTTAATATCATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-386s21c1
Sequence:CCGGCGTATCATATACTCGAGACTTCTCGAGAAGTCTCGAGTATATGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-278s21c1
Sequence:CCGGCGTCATAGAAATAATGCAGAACTCGAGTTCTGCATTATTTCTATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-248s21c1
Sequence:CCGGCCTACCTATAACTGGAATGTTCTCGAGAACATTCCAGTTATAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-322s21c1
Sequence:CCGGTTGCAGAATACTCACTATTTCCTCGAGGAAATAGTGAGTATTCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002423
VALIDATED
MMP7 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 7 (matrilysin, uterine)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002423.2-248s1c1
Sequence:CCGGCCTACCTATAACTGGAATGTTCTCGAGAACATTCCAGTTATAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-935s21c1
Sequence:CCGGCCACTCCATTTAGCAATTATGCTCGAGCATAATTGCTAAATGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002423.2-278s1c1
Sequence:CCGGCGTCATAGAAATAATGCAGAACTCGAGTTCTGCATTATTTCTATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002423.2-409s1c1
Sequence:CCGGCGCATATTACAGTGGATCGATCTCGAGATCGATCCACTGTAATATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002423.2-386s1c1
Sequence:CCGGCGTATCATATACTCGAGACTTCTCGAGAAGTCTCGAGTATATGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002423.2-788s1c1
Sequence:CCGGCCAGGATGATATTAAAGGCATCTCGAGATGCCTTTAATATCATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-386s21c1
Sequence:CCGGCGTATCATATACTCGAGACTTCTCGAGAAGTCTCGAGTATATGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-278s21c1
Sequence:CCGGCGTCATAGAAATAATGCAGAACTCGAGTTCTGCATTATTTCTATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-248s21c1
Sequence:CCGGCCTACCTATAACTGGAATGTTCTCGAGAACATTCCAGTTATAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002423.3-322s21c1
Sequence:CCGGTTGCAGAATACTCACTATTTCCTCGAGGAAATAGTGAGTATTCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)