EMAIL THIS PAGE TO A FRIEND

MMP8

matrix metallopeptidase 8 (neutrophil collagenase)

78 Gene Product Result for
Synonyms: CLG1 HNC MMP-8 PMNL-CL
UniProtKB ID: P22894, Q45F99
Gene ID:
Human(4317) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. However, the enzyme encoded by this gene is stored in secondary granules within neutrophils and is activated by autolytic cleavage. Its function is degradation of type I, II and III collagens. The gene is part of a cluster of MMP genes which localize to chromosome 11q22.3. [provided by RefSeq, Jul 2008]
Mouse(17394) matrix metallopeptidase 8
Rat(63849) matrix metallopeptidase 8
sheep(101120601) matrix metallopeptidase 8 (neutrophil collagenase)
domestic guinea pig(100724670) matrix metallopeptidase 8 (neutrophil collagenase)
naked mole-rat(101716969) matrix metallopeptidase 8 (neutrophil collagenase)
cow(100336575) matrix metallopeptidase 8 (neutrophil collagenase)
Horse(100069005) matrix metallopeptidase 8 (neutrophil collagenase)
domestic cat(101080995) matrix metallopeptidase 8 (neutrophil collagenase)
dog(489429) matrix metallopeptidase 8 (neutrophil collagenase)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
PZ0107 CP-101537 ≥98% (HPLC) human, mouse, rat pricing
PZ0137 CP-471474 ≥98% (HPLC) human, mouse, rat pricing
M2699 Marimastat ≥98% (HPLC) human, mouse, rat pricing
P0047 PD166793 hydrate ≥98% (HPLC) human, mouse, rat pricing
594687 α-Sexithiophene human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047031 MISSION® esiRNA esiRNA human MMP8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002424 Rosetta Predictions human pricing
NM_022221 Rosetta Predictions rat pricing
NM_008611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193713 predicted 778
2 SASI_Hs01_00193714 predicted 568
3 SASI_Hs01_00193716 predicted 1274
4 SASI_Hs02_00333819 predicted 1145
5 SASI_Hs02_00333820 predicted 309
6 SASI_Hs01_00193717 predicted 796
7 SASI_Hs01_00193718 predicted 463
8 SASI_Hs01_00193719 predicted 683
9 SASI_Hs01_00193721 predicted 1517
10 SASI_Hs02_00333821 predicted 766
11 SASI_Hs01_00193715 predicted 1253
12 SASI_Hs01_00193720 predicted 1438
13 SASI_Hs01_00193722 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030939 predicted 735
2 SASI_Rn01_00030940 predicted 706
3 SASI_Rn01_00030941 predicted 1153
4 SASI_Rn01_00030942 predicted 1181
5 SASI_Rn01_00030943 predicted 605
6 SASI_Rn01_00030945 predicted 501
7 SASI_Rn01_00030946 predicted 614
8 SASI_Rn02_00262979 predicted 1140
9 SASI_Rn01_00030947 predicted 526
10 SASI_Rn02_00262980 predicted 755
11 SASI_Rn01_00030938 predicted 1050
12 SASI_Rn01_00030944 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037554 predicted 839
2 SASI_Mm01_00037555 predicted 571
3 SASI_Mm01_00037556 predicted 247
4 SASI_Mm01_00037557 predicted 334
5 SASI_Mm01_00037558 predicted 491
6 SASI_Mm01_00037559 predicted 1587
7 SASI_Mm01_00037560 predicted 606
8 SASI_Mm01_00037561 predicted 1347
9 SASI_Mm01_00037562 predicted 1242
10 SASI_Mm01_00037563 predicted 808
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002424
MMP8 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 8 (neutrophil collagenase)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-768s1c1
Sequence:CCGGGCCTTGATGTATCCCAACTATCTCGAGATAGTTGGGATACATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-257s1c1
Sequence:CCGGGCTTAAAGAAATGCAGCGATTCTCGAGAATCGCTGCATTTCTTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-1389s1c1
Sequence:CCGGCCAAGATATTACGCATTTGATCTCGAGATCAAATGCGTAATATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-597s1c1
Sequence:CCGGCCCAATGGAATCCTTGCTCATCTCGAGATGAGCAAGGATTCCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002424.2-706s21c1
Sequence:CCGGACCAACACCTCCGCAAATTACCTCGAGGTAATTTGCGGAGGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002424.2-1901s21c1
Sequence:CCGGTGGTTAGAAGTAAGGATTATACTCGAGTATAATCCTTACTTCTAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-205s1c1
Sequence:CCGGGCAACCAGTATCAGTCTACAACTCGAGTTGTAGACTGATACTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002424.2-1278s21c1
Sequence:CCGGCCAATTCTGGAGATATGATAACTCGAGTTATCATATCTCCAGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002424
MMP8 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 8 (neutrophil collagenase)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-768s1c1
Sequence:CCGGGCCTTGATGTATCCCAACTATCTCGAGATAGTTGGGATACATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-257s1c1
Sequence:CCGGGCTTAAAGAAATGCAGCGATTCTCGAGAATCGCTGCATTTCTTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-1389s1c1
Sequence:CCGGCCAAGATATTACGCATTTGATCTCGAGATCAAATGCGTAATATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-597s1c1
Sequence:CCGGCCCAATGGAATCCTTGCTCATCTCGAGATGAGCAAGGATTCCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002424.2-706s21c1
Sequence:CCGGACCAACACCTCCGCAAATTACCTCGAGGTAATTTGCGGAGGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002424.2-1901s21c1
Sequence:CCGGTGGTTAGAAGTAAGGATTATACTCGAGTATAATCCTTACTTCTAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-205s1c1
Sequence:CCGGGCAACCAGTATCAGTCTACAACTCGAGTTGTAGACTGATACTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002424.2-1278s21c1
Sequence:CCGGCCAATTCTGGAGATATGATAACTCGAGTTATCATATCTCCAGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002424
MMP8 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 8 (neutrophil collagenase)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-768s1c1
Sequence:CCGGGCCTTGATGTATCCCAACTATCTCGAGATAGTTGGGATACATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-257s1c1
Sequence:CCGGGCTTAAAGAAATGCAGCGATTCTCGAGAATCGCTGCATTTCTTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-1389s1c1
Sequence:CCGGCCAAGATATTACGCATTTGATCTCGAGATCAAATGCGTAATATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-597s1c1
Sequence:CCGGCCCAATGGAATCCTTGCTCATCTCGAGATGAGCAAGGATTCCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002424.2-706s21c1
Sequence:CCGGACCAACACCTCCGCAAATTACCTCGAGGTAATTTGCGGAGGTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002424.2-1901s21c1
Sequence:CCGGTGGTTAGAAGTAAGGATTATACTCGAGTATAATCCTTACTTCTAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002424.1-205s1c1
Sequence:CCGGGCAACCAGTATCAGTCTACAACTCGAGTTGTAGACTGATACTGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002424.2-1278s21c1
Sequence:CCGGCCAATTCTGGAGATATGATAACTCGAGTTATCATATCTCCAGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008611
MMP8 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 8 (neutrophil collagenase)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000031220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-1021s1c1
Sequence:CCGGCCTCAATTTCATATCTCTGTTCTCGAGAACAGAGATATGAAATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-1445s1c1
Sequence:CCGGGCAAGAAGCAATTTATGGCTTCTCGAGAAGCCATAAATTGCTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-776s1c1
Sequence:CCGGGCCTTGATGTACCCAAACTATCTCGAGATAGTTTGGGTACATCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-415s1c1
Sequence:CCGGCCTGACCTACAGGATTATAAACTCGAGTTTATAATCCTGTAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008611
MMP8 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 8 (neutrophil collagenase)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000031220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-1021s1c1
Sequence:CCGGCCTCAATTTCATATCTCTGTTCTCGAGAACAGAGATATGAAATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-1445s1c1
Sequence:CCGGGCAAGAAGCAATTTATGGCTTCTCGAGAAGCCATAAATTGCTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-776s1c1
Sequence:CCGGGCCTTGATGTACCCAAACTATCTCGAGATAGTTTGGGTACATCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-415s1c1
Sequence:CCGGCCTGACCTACAGGATTATAAACTCGAGTTTATAATCCTGTAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008611
MMP8 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 8 (neutrophil collagenase)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000031220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-1021s1c1
Sequence:CCGGCCTCAATTTCATATCTCTGTTCTCGAGAACAGAGATATGAAATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-1445s1c1
Sequence:CCGGGCAAGAAGCAATTTATGGCTTCTCGAGAAGCCATAAATTGCTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-776s1c1
Sequence:CCGGGCCTTGATGTACCCAAACTATCTCGAGATAGTTTGGGTACATCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008611.2-415s1c1
Sequence:CCGGCCTGACCTACAGGATTATAAACTCGAGTTTATAATCCTGTAGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)