EMAIL THIS PAGE TO A FRIEND

MMP9

matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

125 Gene Product Result for
Synonyms: CLG4B GELB MANDP2 MMP-9
Gene ID:
Human(4318) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The enzyme encoded by this gene degrades type IV and V collagens. Studies in rhesus monkeys suggest that the enzyme is involved in IL-8-induced mobilization of hematopoietic progenitor cells from bone marrow, and murine studies suggest a role in tumor-associated tissue remodeling. [provided by RefSeq, Jul 2008]
Mouse(17395) matrix metallopeptidase 9
Rat(81687) matrix metallopeptidase 9
Zebrafish(406397) matrix metalloproteinase 9
dog(403885) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
cow(282871) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Horse(100169862) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Horse(100056599) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
domestic cat(101084185) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
chicken(395387) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
naked mole-rat(101717243) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Domestic Rabbit(100008993) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
domestic guinea pig(100728510) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
sheep(100192422) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Gene Class: Calcium_Binding
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
M9570 Anti-Matrix Metalloproteinase-9 antibody produced in goat affinity isolated antibody mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
M5177 Anti-Matrix Metalloproteinase-9, C-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
SAB4501896 Anti-MMP-9, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
HPA001238 Anti-MMP9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
AV33090 Anti-MMP9 antibody produced in rabbit IgG fraction of antiserum canine, rabbit, bovine, mouse, human, rat, sheep, zebrafish, guinea pig, pig, horse
immunohistochemistry, western blot pricing
HPA063909 Anti-MMP9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB5200303 Monoclonal Anti-Mmp9 - Alkaline Phosphatase antibody produced in mouse clone S51-82, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200304 Monoclonal Anti-Mmp9 - Apc antibody produced in mouse clone S51-82, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200295 Monoclonal Anti-Mmp9 - Atto 390 antibody produced in mouse clone S51-82, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200296 Monoclonal Anti-Mmp9 - Atto 488 antibody produced in mouse clone S51-82, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200297 Monoclonal Anti-Mmp9 - Atto 565 antibody produced in mouse clone S51-82, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200298 Monoclonal Anti-Mmp9 - Atto 594 antibody produced in mouse clone S51-82, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200299 Monoclonal Anti-Mmp9 - Atto 633 antibody produced in mouse clone S51-82, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200300 Monoclonal Anti-Mmp9 - Atto 655 antibody produced in mouse clone S51-82, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200301 Monoclonal Anti-Mmp9 - Atto 680 antibody produced in mouse clone S51-82, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200302 Monoclonal Anti-Mmp9 - Atto 700 antibody produced in mouse clone S51-82, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200305 Monoclonal Anti-Mmp9 - Biotin antibody produced in mouse clone S51-82, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200306 Monoclonal Anti-Mmp9 - Fitc antibody produced in mouse clone S51-82, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200307 Monoclonal Anti-Mmp9 - Hrp antibody produced in mouse clone S51-82, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200308 Monoclonal Anti-Mmp9 - Pe/Atto 594 antibody produced in mouse clone S51-82, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200309 Monoclonal Anti-Mmp9 - Percp antibody produced in mouse clone S51-82, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200310 Monoclonal Anti-Mmp9 - Rpe antibody produced in mouse clone S51-82, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200311 Monoclonal Anti-Mmp9 - Streptavidin antibody produced in mouse clone S51-82, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200294 Monoclonal Anti-Mmp9 antibody produced in mouse clone S51-82, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
AMAB90805 Monoclonal Anti-MMP9 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0539, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90804 Monoclonal Anti-MMP9 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0538, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5300247 Monoclonal Anti-MMP9 antibody produced in mouse clone 5G3, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300248 Monoclonal Anti-MMP9 antibody produced in mouse clone 5C3, ascites fluid human
ELISA, flow cytometry, western blot pricing
AMAB90806 Monoclonal Anti-MMP9 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0542, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1402274 Monoclonal Anti-MMP9 antibody produced in mouse clone 2H4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004994 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
ABT544 Anti-MMP-9 Anti-MMP-9, Cat. No. ABT544, is a rabbit polyclonal antibody that detects Matrix Metalloroteinase-9 and is tested for use in Immunohistochemistry (Paraffin) and Western Blotting.. pricing
MABT171 Anti-MMP-9 (Active) Antibody, clone 4A3 This Anti-MMP-9 (Active) Antibody, clone 4A3 is validated for use in Western Blotting, IHC for the detection of MMP-9 (Active). pricing
AB13458 Anti-MMP-9 Antibody Anti-MMP-9 Antibody detects level of MMP-9 & has been published & validated for use in WB, IH, IH(P). pricing
AB19016 Anti-MMP-9 Antibody, Catalytic domain Anti-MMP-9 Antibody, Catalytic domain is an antibody against MMP-9 for use in IH, IP & WB. pricing
MABT531 Anti-MMP-9 Antibody, clone 3D6.3 This mouse monoclonal Anti-MMP-9 Antibody, clone 3D6.3, Cat. No. MABT531 is tested in Immunohistochemistry (Paraffin) and Western Blotting for the detection of MMP-9. pricing
MAB13458 Anti-MMP-9 Antibody, clone 9D4.2 Detect MMP-9 using this Anti-MMP-9 Antibody, clone 9D4.2 validated for use in ELISA & WB. pricing
MAB13415 Anti-MMP-9 Antibody, clone GE-213 Anti-MMP-9 Antibody, clone GE-213 is an antibody against MMP-9 for use in IP, WB & IH. pricing
AB6008 Anti-MMP-9 Antibody, Hinge region Detect MMP-9 using this Anti-MMP-9 Antibody, Hinge region validated for use in WB, IH & IP. pricing
AB6001 Anti-MMP-9 Antibody, NT Anti-MMP-9 Antibody, N-terminus is an antibody against MMP-9 for use in WB. pricing
CC1048 MMP-9, human, proform pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004994 Rosetta Predictions human pricing
NM_031055 Rosetta Predictions rat pricing
NM_013599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338726 predicted 337
2 SASI_Hs01_00174056 predicted 402
3 SASI_Hs01_00174057 predicted 2061
4 SASI_Hs02_00338727 predicted 619
5 SASI_Hs01_00174058 predicted 2090
6 SASI_Hs01_00174061 predicted 1557
7 SASI_Hs01_00174062 predicted 1261
8 SASI_Hs01_00174063 predicted 546
9 SASI_Hs01_00174064 predicted 1278
10 SASI_Hs01_00174065 predicted 413
11 SASI_Hs01_00174059 predicted 1594
12 SASI_Hs01_00174060 predicted 1922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037990 predicted 953
2 SASI_Rn01_00037991 predicted 2192
3 SASI_Rn02_00264287 predicted 363
4 SASI_Rn01_00037992 predicted 905
5 SASI_Rn01_00037993 predicted 1878
6 SASI_Rn01_00037994 predicted 489
7 SASI_Rn01_00037996 predicted 1614
8 SASI_Rn01_00037998 predicted 1396
9 SASI_Rn01_00037999 predicted 266
10 SASI_Rn02_00264288 predicted 350
11 SASI_Rn01_00037995 predicted 973
12 SASI_Rn01_00037997 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054138 predicted 1809
2 SASI_Mm01_00054139 predicted 971
3 SASI_Mm01_00054140 predicted 268
4 SASI_Mm01_00054141 predicted 1957
5 SASI_Mm01_00054142 predicted 689
6 SASI_Mm01_00054143 predicted 383
7 SASI_Mm01_00054144 predicted 1684
8 SASI_Mm01_00054145 predicted 773
9 SASI_Mm01_00054146 predicted 1123
10 SASI_Mm01_00054147 predicted 1132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013599
MMP9 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-2056s1c1
Sequence:CCGGCAGTACCAAGACAAAGCCTATCTCGAGATAGGCTTTGTCTTGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-1293s1c1
Sequence:CCGGCCCTCTGAATAAAGACGACATCTCGAGATGTCGTCTTTATTCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-969s1c1
Sequence:CCGGCCAGGATAAACTGTATGGCTTCTCGAGAAGCCATACAGTTTATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-662s1c1
Sequence:CCGGCCACTTACTATGGAAACTCAACTCGAGTTGAGTTTCCATAGTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-145s1c1
Sequence:CCGGGAGGCATACTTGTACCGCTATCTCGAGATAGCGGTACAAGTATGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013599
MMP9 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-2056s1c1
Sequence:CCGGCAGTACCAAGACAAAGCCTATCTCGAGATAGGCTTTGTCTTGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-1293s1c1
Sequence:CCGGCCCTCTGAATAAAGACGACATCTCGAGATGTCGTCTTTATTCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-969s1c1
Sequence:CCGGCCAGGATAAACTGTATGGCTTCTCGAGAAGCCATACAGTTTATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-662s1c1
Sequence:CCGGCCACTTACTATGGAAACTCAACTCGAGTTGAGTTTCCATAGTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-145s1c1
Sequence:CCGGGAGGCATACTTGTACCGCTATCTCGAGATAGCGGTACAAGTATGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013599
MMP9 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-2056s1c1
Sequence:CCGGCAGTACCAAGACAAAGCCTATCTCGAGATAGGCTTTGTCTTGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-1293s1c1
Sequence:CCGGCCCTCTGAATAAAGACGACATCTCGAGATGTCGTCTTTATTCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-969s1c1
Sequence:CCGGCCAGGATAAACTGTATGGCTTCTCGAGAAGCCATACAGTTTATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-662s1c1
Sequence:CCGGCCACTTACTATGGAAACTCAACTCGAGTTGAGTTTCCATAGTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013599.2-145s1c1
Sequence:CCGGGAGGCATACTTGTACCGCTATCTCGAGATAGCGGTACAAGTATGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004994
MMP9 MISSION shRNA Bacterial Glycerol Stock
matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004994.1-373s1c1
Sequence:CCGGCCACAACATCACCTATTGGATCTCGAGATCCAATAGGTGATGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004994.1-884s1c1
Sequence:CCGGCAGTTTCCATTCATCTTCCAACTCGAGTTGGAAGATGAATGGAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004994.2-2214s21c1
Sequence:CCGGGCCGGATACAAACTGGTATTCCTCGAGGAATACCAGTTTGTATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004994.2-610s21c1
Sequence:CCGGCATTCAGGGAGACGCCCATTTCTCGAGAAATGGGCGTCTCCCTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004994.2-196s21c1
Sequence:CCGGGATGCGTGGAGAGTCGAAATCCTCGAGGATTTCGACTCTCCACGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004994.2-1311s21c1
Sequence:CCGGTGCATAAGGACGACGTGAATGCTCGAGCATTCACGTCGTCCTTATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004994
MMP9 MISSION shRNA shRNA Plasmid DNA
matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004994.1-373s1c1
Sequence:CCGGCCACAACATCACCTATTGGATCTCGAGATCCAATAGGTGATGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004994.1-884s1c1
Sequence:CCGGCAGTTTCCATTCATCTTCCAACTCGAGTTGGAAGATGAATGGAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004994.2-2214s21c1
Sequence:CCGGGCCGGATACAAACTGGTATTCCTCGAGGAATACCAGTTTGTATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004994.2-610s21c1
Sequence:CCGGCATTCAGGGAGACGCCCATTTCTCGAGAAATGGGCGTCTCCCTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004994.2-196s21c1
Sequence:CCGGGATGCGTGGAGAGTCGAAATCCTCGAGGATTTCGACTCTCCACGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004994.2-1311s21c1
Sequence:CCGGTGCATAAGGACGACGTGAATGCTCGAGCATTCACGTCGTCCTTATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004994
MMP9 MISSION shRNA Lentiviral Transduction Particles
matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004994.1-373s1c1
Sequence:CCGGCCACAACATCACCTATTGGATCTCGAGATCCAATAGGTGATGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004994.1-884s1c1
Sequence:CCGGCAGTTTCCATTCATCTTCCAACTCGAGTTGGAAGATGAATGGAAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004994.2-2214s21c1
Sequence:CCGGGCCGGATACAAACTGGTATTCCTCGAGGAATACCAGTTTGTATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004994.2-610s21c1
Sequence:CCGGCATTCAGGGAGACGCCCATTTCTCGAGAAATGGGCGTCTCCCTGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004994.2-196s21c1
Sequence:CCGGGATGCGTGGAGAGTCGAAATCCTCGAGGATTTCGACTCTCCACGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004994.2-1311s21c1
Sequence:CCGGTGCATAAGGACGACGTGAATGCTCGAGCATTCACGTCGTCCTTATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)