MMP9

matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

118 Gene Product Result for

Synonyms: CLG4B GELB MANDP2 MMP-9

Species: Human MMP9(4318), Mouse Mmp9(17395), Rat Mmp9(81687), Zebrafish mmp9(406397), dog MMP9(403885), cow MMP9(282871), Horse MMP9(100169862), Horse MMP9(100056599), domestic cat MMP9(101084185), chicken MMP9(395387), naked mole-rat Mmp9(101717243), Domestic Rabbit MMP9(100008993), domestic guinea pig Mmp9(100728510), sheep MMP9(100192422)

UniProtKB ID: P14780, B2R7V9, Q3LR70, Q8N725, Q9H4Z1, Q9UCJ9, Q9UCL1, Q9UDK2

Gene ID:

Human(4318) Summary: Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. The enzyme encoded by this gene degrades type IV and V collagens. Studies in rhesus monkeys suggest that the enzyme is involved in IL-8-induced mobilization of hematopoietic progenitor cells from bone marrow, and murine studies suggest a role in tumor-associated tissue remodeling. [provided by RefSeq, Jul 2008]

Mouse(17395) matrix metallopeptidase 9

Rat(81687) matrix metallopeptidase 9

Zebrafish(406397) matrix metalloproteinase 9

dog(403885) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

cow(282871) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

Horse(100169862) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

Horse(100056599) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

domestic cat(101084185) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

chicken(395387) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

naked mole-rat(101717243) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

Domestic Rabbit(100008993) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

domestic guinea pig(100728510) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

sheep(100192422) matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)

Gene Class: Calcium_Binding

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

M9570	Anti-Matrix Metalloproteinase-9 antibody produced in goat affinity isolated antibody	mouse	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

M5177	Anti-Matrix Metalloproteinase-9, C-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous glycerol solution	human	western blot	pricing

MABT171	Anti-MMP-9 (Active) Antibody, clone 4A3 clone 4A3, from mouse	human	immunohistochemistry, western blot	pricing

SAB4501896	Anti-MMP-9 antibody produced in rabbit affinity isolated antibody	human	ELISA, immunohistochemistry, western blot	pricing

AB19016	Anti-MMP-9 Antibody, Catalytic domain clone, Chemicon^®, from rabbit	human, mouse, rat, mouse, rat, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

MABT531	Anti-MMP-9 Antibody, clone 3D6.3 clone 3D6.3, from mouse	human, human, human	immunohistochemistry, western blot	pricing

MAB13458	Anti-MMP-9 Antibody, clone 9D4.2 clone 9D4.2, Chemicon^®, from mouse	human	ELISA, western blot	pricing

MAB13415	Anti-MMP-9 Antibody, clone GE-213 clone GE-213, Chemicon^®, from mouse	human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

AB6001	Anti-MMP-9 Antibody, NT clone, from rabbit, purified by affinity chromatography	canine, horse, human, human, rat, primate, monkey, pig	western blot	pricing

SAB5700152	Anti-MMP9 antibody produced in rabbit	human, rat, mouse	immunofluorescence, western blot	pricing

SAB5700633	Anti-MMP9 antibody produced in rabbit	rat, mouse, human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB5700679	Anti-MMP9 antibody produced in rabbit	human, rat, mouse	western blot	pricing

HPA001238	Anti-MMP9 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry	pricing

HPA063909	Anti-MMP9 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

AV33090	Anti-MMP9 antibody produced in rabbit IgG fraction of antiserum	guinea pig, dog, sheep, bovine, horse, rabbit, rat, mouse, human	immunohistochemistry, western blot	pricing

SAB5200303	Monoclonal Anti-Mmp9 - Alkaline Phosphatase antibody produced in mouse clone S51-82, purified immunoglobulin	rat, mouse, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200304	Monoclonal Anti-Mmp9 - Apc antibody produced in mouse clone S51-82, purified immunoglobulin	human, mouse, rat	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200295	Monoclonal Anti-Mmp9 - Atto 390 antibody produced in mouse clone S51-82, purified immunoglobulin	rat, human, mouse	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200296	Monoclonal Anti-Mmp9 - Atto 488 antibody produced in mouse clone S51-82, purified immunoglobulin	human, mouse, rat	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200297	Monoclonal Anti-Mmp9 - Atto 565 antibody produced in mouse clone S51-82, purified immunoglobulin	mouse, human, rat	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200298	Monoclonal Anti-Mmp9 - Atto 594 antibody produced in mouse clone S51-82, purified immunoglobulin	rat, human, mouse	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200299	Monoclonal Anti-Mmp9 - Atto 633 antibody produced in mouse clone S51-82, purified immunoglobulin	rat, mouse, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200300	Monoclonal Anti-Mmp9 - Atto 655 antibody produced in mouse clone S51-82, purified immunoglobulin	mouse, human, rat	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200301	Monoclonal Anti-Mmp9 - Atto 680 antibody produced in mouse clone S51-82, purified immunoglobulin	rat, mouse, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200302	Monoclonal Anti-Mmp9 - Atto 700 antibody produced in mouse clone S51-82, purified immunoglobulin	human, rat, mouse	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200305	Monoclonal Anti-Mmp9 - Biotin antibody produced in mouse clone S51-82, purified immunoglobulin	mouse, human, rat	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200306	Monoclonal Anti-Mmp9 - Fitc antibody produced in mouse clone S51-82, purified immunoglobulin	human, rat, mouse	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200307	Monoclonal Anti-Mmp9 - Hrp antibody produced in mouse clone S51-82, purified immunoglobulin	mouse, rat, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200308	Monoclonal Anti-Mmp9 - Pe/Atto 594 antibody produced in mouse clone S51-82, purified immunoglobulin	human, rat, mouse	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200309	Monoclonal Anti-Mmp9 - Percp antibody produced in mouse clone S51-82, purified immunoglobulin	rat, mouse, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200310	Monoclonal Anti-Mmp9 - Rpe antibody produced in mouse clone S51-82, purified immunoglobulin	rat, mouse, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200311	Monoclonal Anti-Mmp9 - Streptavidin antibody produced in mouse clone S51-82, purified immunoglobulin	human, mouse, rat	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB5200294	Monoclonal Anti-Mmp9 antibody produced in mouse clone S51-82, purified immunoglobulin	mouse, rat, human	immunohistochemistry, immunoprecipitation (IP), western blot	pricing

SAB1402274	Monoclonal Anti-MMP9 antibody produced in mouse clone 2H4, purified immunoglobulin, buffered aqueous solution	human	ELISA, immunofluorescence, proximity ligation assay, western blot	pricing

AMAB90805	Monoclonal Anti-MMP9 antibody produced in mouse Prestige Antibodies^® Powered by Atlas Antibodies, clone CL0539, purified immunoglobulin, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

AMAB90804	Monoclonal Anti-MMP9 antibody produced in mouse Prestige Antibodies^® Powered by Atlas Antibodies, clone CL0538, purified immunoglobulin, buffered aqueous glycerol solution	human	immunohistochemistry, western blot	pricing

SAB5300247	Monoclonal Anti-MMP9 antibody produced in mouse clone 5G3, ascites fluid	human	ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot	pricing

SAB5300248	Monoclonal Anti-MMP9 antibody produced in mouse clone 5C3, ascites fluid	human	ELISA, flow cytometry, western blot	pricing

AMAB90806	Monoclonal Anti-MMP9 antibody produced in mouse Prestige Antibodies^® Powered by Atlas Antibodies, clone CL0542, purified immunoglobulin, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

Small Molecule - Inhibitor

Product #	Description	Species	Add to Cart

F8755	Fenbufen analytical standard	human	pricing

PZ0107	CP-101537 ≥98% (HPLC)	human, mouse, rat	pricing

PZ0137	CP-471474 ≥98% (HPLC)	human, mouse, rat	pricing

M2699	Marimastat ≥98% (HPLC)	human, mouse, rat	pricing

P0047	PD166793 hydrate ≥98% (HPLC)	human, mouse, rat	pricing

594687	α-Sexithiophene	human, rat	pricing

Proteins

Product #	Description	Species	Add to Cart

M8945	Matrix Metalloproteinase-9 human recombinant, >90% (SDS-PAGE), buffered aqueous solution	human	pricing

SRP6271	MMP-9 human recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE)	human	pricing

SAE0077	MMP-9 human recombinant, ≥1,300 pmol/min/μg, expressed in HEK 293 cells	human	pricing

SAE0078	MMP-9 pre-activated human recombinant, ≥1,300 pmol/min/μg, expressed in HEK 293 cells	human	pricing

CC1048	MMP-9, human, proform	human	pricing

APREST83039	PrEST Antigen MMP9 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST88060	PrEST Antigen MMP9 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST23236	SILu^™PrEST MMP9 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST23237	SILu^™PrEST MMP9 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

ELISA

Product #	Description	Species	Add to Cart

RAB0372	Human MMP-9 ELISA Kit for serum, plasma, cell culture supernatant and urine	human	pricing

RAB0373	Mouse pro-MMP-9 ELISA Kit for serum, plasma and cell culture supernatant	mouse	pricing

RAB1112	Rabbit MMP-9 ELISA Kit for cell culture supernatants, plasma, and serum samples	rabbit	pricing

RAB1817	Rhesus Macaque MMP-9 ELISA for serum, plasma and cell culture supernatants	rhesus macaque	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR00683	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, MMP9	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_004994	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_004994	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_004994	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_013599	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_013599	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_013599	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU010531	MISSION^® esiRNA targeting human MMP9	human	pricing

EMU054211	MISSION^® esiRNA targeting mouse Mmp9	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_004994	Rosetta Predictions	human	pricing
NM_031055	Rosetta Predictions	rat	pricing
NM_013599	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_004994	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs02_00338726 predicted	337
2	SASI_Hs01_00174056 predicted	402
3	SASI_Hs01_00174057 predicted	2061
4	SASI_Hs02_00338727 predicted	619
5	SASI_Hs01_00174058 predicted	2090
6	SASI_Hs01_00174061 predicted	1557
7	SASI_Hs01_00174062 predicted	1261
8	SASI_Hs01_00174063 predicted	546
9	SASI_Hs01_00174064 predicted	1278
10	SASI_Hs01_00174065 predicted	413
11	SASI_Hs01_00174059 predicted	1594
12	SASI_Hs01_00174060 predicted	1922

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_031055	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00037990 predicted	953
2	SASI_Rn01_00037991 predicted	2192
3	SASI_Rn02_00264287 predicted	363
4	SASI_Rn01_00037992 predicted	905
5	SASI_Rn01_00037993 predicted	1878
6	SASI_Rn01_00037994 predicted	489
7	SASI_Rn01_00037996 predicted	1614
8	SASI_Rn01_00037998 predicted	1396
9	SASI_Rn01_00037999 predicted	266
10	SASI_Rn02_00264288 predicted	350
11	SASI_Rn01_00037995 predicted	973
12	SASI_Rn01_00037997 predicted	1136

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_013599	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00054138 predicted	1809
2	SASI_Mm01_00054139 predicted	971
3	SASI_Mm01_00054140 predicted	268
4	SASI_Mm01_00054141 predicted	1957
5	SASI_Mm01_00054142 predicted	689
6	SASI_Mm01_00054143 predicted	383
7	SASI_Mm01_00054144 predicted	1684
8	SASI_Mm01_00054145 predicted	773
9	SASI_Mm01_00054146 predicted	1123
10	SASI_Mm01_00054147 predicted	1132

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_004994	MMP9 MISSION shRNA Bacterial Glycerol Stock matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	Human

6 Products Total

TRC Number
We do not support the configuration options you have chosen
TRCN0000373008
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004994.2-610s21c1
	Sequence:CCGGCATTCAGGGAGACGCCCATTTCTCGAGAAATGGGCGTCTCCCTGAATGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000051441
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004994.1-884s1c1
	Sequence:CCGGCAGTTTCCATTCATCTTCCAACTCGAGTTGGAAGATGAATGGAAACTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000051438
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004994.1-373s1c1
	Sequence:CCGGCCACAACATCACCTATTGGATCTCGAGATCCAATAGGTGATGTTGTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000373061
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004994.2-2214s21c1
	Sequence:CCGGGCCGGATACAAACTGGTATTCCTCGAGGAATACCAGTTTGTATCCGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000373054
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004994.2-1311s21c1
	Sequence:CCGGTGCATAAGGACGACGTGAATGCTCGAGCATTCACGTCGTCCTTATGCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000373007
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004994.2-196s21c1
	Sequence:CCGGGATGCGTGGAGAGTCGAAATCCTCGAGGATTTCGACTCTCCACGCATCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_004994	MMP9 MISSION shRNA shRNA Plasmid DNA matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	Human

6 Products Total

TRC Number		Vector
We do not support the configuration options you have chosen
TRCN0000373008
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004994.2-610s21c1
	Sequence:CCGGCATTCAGGGAGACGCCCATTTCTCGAGAAATGGGCGTCTCCCTGAATGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000051441
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004994.1-884s1c1
	Sequence:CCGGCAGTTTCCATTCATCTTCCAACTCGAGTTGGAAGATGAATGGAAACTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000051438
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004994.1-373s1c1
	Sequence:CCGGCCACAACATCACCTATTGGATCTCGAGATCCAATAGGTGATGTTGTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000373061
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004994.2-2214s21c1
	Sequence:CCGGGCCGGATACAAACTGGTATTCCTCGAGGAATACCAGTTTGTATCCGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000373054
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004994.2-1311s21c1
	Sequence:CCGGTGCATAAGGACGACGTGAATGCTCGAGCATTCACGTCGTCCTTATGCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000373007
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004994.2-196s21c1
	Sequence:CCGGGATGCGTGGAGAGTCGAAATCCTCGAGGATTTCGACTCTCCACGCATCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_004994	MMP9 MISSION shRNA Lentiviral Transduction Particles matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	Human

6 Products Total

TRC Number	Volume	Vector
We do not support the configuration options you have chosen
TRCN0000373008
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004994.2-610s21c1
	Sequence:CCGGCATTCAGGGAGACGCCCATTTCTCGAGAAATGGGCGTCTCCCTGAATGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000051441
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004994.1-884s1c1
	Sequence:CCGGCAGTTTCCATTCATCTTCCAACTCGAGTTGGAAGATGAATGGAAACTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000051438
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_004994.1-373s1c1
	Sequence:CCGGCCACAACATCACCTATTGGATCTCGAGATCCAATAGGTGATGTTGTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000373061
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_004994.2-2214s21c1
	Sequence:CCGGGCCGGATACAAACTGGTATTCCTCGAGGAATACCAGTTTGTATCCGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000373054
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004994.2-1311s21c1
	Sequence:CCGGTGCATAAGGACGACGTGAATGCTCGAGCATTCACGTCGTCCTTATGCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000373007
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_004994.2-196s21c1
	Sequence:CCGGGATGCGTGGAGAGTCGAAATCCTCGAGGATTTCGACTCTCCACGCATCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_013599	MMP9 MISSION shRNA Bacterial Glycerol Stock matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	Mouse

5 Products Total

TRC Number
We do not support the configuration options you have chosen
TRCN0000031233
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-2056s1c1
	Sequence:CCGGCAGTACCAAGACAAAGCCTATCTCGAGATAGGCTTTGTCTTGGTACTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031229
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-1293s1c1
	Sequence:CCGGCCCTCTGAATAAAGACGACATCTCGAGATGTCGTCTTTATTCAGAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031231
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-145s1c1
	Sequence:CCGGGAGGCATACTTGTACCGCTATCTCGAGATAGCGGTACAAGTATGCCTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031232
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-662s1c1
	Sequence:CCGGCCACTTACTATGGAAACTCAACTCGAGTTGAGTTTCCATAGTAAGTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031230
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-969s1c1
	Sequence:CCGGCCAGGATAAACTGTATGGCTTCTCGAGAAGCCATACAGTTTATCCTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_013599	MMP9 MISSION shRNA shRNA Plasmid DNA matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	Mouse

5 Products Total

TRC Number		Vector
We do not support the configuration options you have chosen
TRCN0000031233
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-2056s1c1
	Sequence:CCGGCAGTACCAAGACAAAGCCTATCTCGAGATAGGCTTTGTCTTGGTACTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000031229
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-1293s1c1
	Sequence:CCGGCCCTCTGAATAAAGACGACATCTCGAGATGTCGTCTTTATTCAGAGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000031231
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-145s1c1
	Sequence:CCGGGAGGCATACTTGTACCGCTATCTCGAGATAGCGGTACAAGTATGCCTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000031232
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-662s1c1
	Sequence:CCGGCCACTTACTATGGAAACTCAACTCGAGTTGAGTTTCCATAGTAAGTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000031230
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-969s1c1
	Sequence:CCGGCCAGGATAAACTGTATGGCTTCTCGAGAAGCCATACAGTTTATCCTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_013599	MMP9 MISSION shRNA Lentiviral Transduction Particles matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	Mouse

5 Products Total

TRC Number	Volume	Vector
We do not support the configuration options you have chosen
TRCN0000031233
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-2056s1c1
	Sequence:CCGGCAGTACCAAGACAAAGCCTATCTCGAGATAGGCTTTGTCTTGGTACTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031229
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-1293s1c1
	Sequence:CCGGCCCTCTGAATAAAGACGACATCTCGAGATGTCGTCTTTATTCAGAGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031231
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-145s1c1
	Sequence:CCGGGAGGCATACTTGTACCGCTATCTCGAGATAGCGGTACAAGTATGCCTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031232
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-662s1c1
	Sequence:CCGGCCACTTACTATGGAAACTCAACTCGAGTTGAGTTTCCATAGTAAGTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000031230
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_013599.2-969s1c1
	Sequence:CCGGCCAGGATAAACTGTATGGCTTCTCGAGAAGCCATACAGTTTATCCTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart