EMAIL THIS PAGE TO A FRIEND

MMRN1

multimerin 1

107 Gene Product Result for
Synonyms: ECM EMILIN4 GPIa* MMRN
UniProtKB ID: Q13201, Q4W5L1, Q6P3T8, Q6ZUL9
Gene ID:
Human(22915) Summary: Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]
Mouse(70945) multimerin 1
Rat(500152) multimerin 1
chicken(428741) multimerin 1
Horse(100053317) multimerin 1
cow(516574) multimerin 1
dog(487858) multimerin 1
sheep(101117586) multimerin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007351 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042581 MISSION® esiRNA esiRNA human MMRN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007351 Rosetta Predictions human pricing
XM_001065496 Rosetta Predictions rat pricing
XM_001071128 Rosetta Predictions rat pricing
XM_284198 Rosetta Predictions mouse pricing
XM_909131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343445 predicted 2743
2 SASI_Hs02_00343446 predicted 1500
3 SASI_Hs01_00079629 predicted 1320
4 SASI_Hs01_00079631 predicted 1225
5 SASI_Hs01_00079632 predicted 2647
6 SASI_Hs02_00343447 predicted 454
7 SASI_Hs01_00079634 predicted 3101
8 SASI_Hs02_00343448 predicted 1408
9 SASI_Hs01_00079635 predicted 261
10 SASI_Hs01_00079636 predicted 1042
11 SASI_Hs01_00079630 predicted 2446
12 SASI_Hs01_00079633 predicted 2764
13 SASI_Hs01_00079637 predicted 3755
14 SASI_Hs01_00079638 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314350 predicted 2006
2 SASI_Rn02_00314351 predicted 1354
3 SASI_Rn02_00314352 predicted 2564
4 SASI_Rn02_00314353 predicted 1183
5 SASI_Rn02_00314354 predicted 3365
6 SASI_Rn02_00314355 predicted 911
7 SASI_Rn02_00314356 predicted 3437
8 SASI_Rn02_00314357 predicted 2971
9 SASI_Rn02_00314358 predicted 3809
10 SASI_Rn02_00314359 predicted 3645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071128 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333965 predicted 481
2 SASI_Rn02_00333966 predicted 818
3 SASI_Rn02_00333967 predicted 913
4 SASI_Rn02_00333968 predicted 301
5 SASI_Rn02_00333969 predicted 909
6 SASI_Rn02_00333970 predicted 474
7 SASI_Rn02_00333971 predicted 210
8 SASI_Rn02_00333972 predicted 572
9 SASI_Rn02_00333973 predicted 588
10 SASI_Rn02_00333974 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425635 predicted 1998
2 SASI_Mm02_00425636 predicted 2700
3 SASI_Mm01_00266090 predicted 3483
4 SASI_Mm01_00266091 predicted 3245
5 SASI_Mm01_00266094 predicted 2119
6 SASI_Mm01_00266095 predicted 2492
7 SASI_Mm02_00425637 predicted 3542
8 SASI_Mm02_00425638 predicted 3819
9 SASI_Mm02_00425639 predicted 2405
10 SASI_Mm02_00425640 predicted 2393
11 SASI_Mm01_00266088 predicted 2842
12 SASI_Mm01_00266089 predicted 730
13 SASI_Mm01_00266092 predicted 1302
14 SASI_Mm01_00266093 predicted 1304
15 SASI_Mm01_00266096 predicted 1772
16 SASI_Mm01_00266097 predicted 1611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434655 predicted 2837
2 SASI_Mm02_00434656 predicted 729
3 SASI_Mm02_00434657 predicted 3481
4 SASI_Mm02_00434658 predicted 3242
5 SASI_Mm02_00434659 predicted 1294
6 SASI_Mm02_00434660 predicted 1304
7 SASI_Mm02_00434661 predicted 2118
8 SASI_Mm02_00434662 predicted 2499
9 SASI_Mm02_00434663 predicted 1767
10 SASI_Mm02_00434664 predicted 1606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007351
MMRN1 MISSION shRNA Bacterial Glycerol Stock
multimerin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007351.2-836s21c1
Sequence:CCGGTGTCTATAGGATGCAACATAACTCGAGTTATGTTGCATCCTATAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007351.2-2342s21c1
Sequence:CCGGTAATAGTGAGATCCATCATAACTCGAGTTATGATGGATCTCACTATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007351.2-4231s21c1
Sequence:CCGGTTTACGTTGAGTTGATCAATTCTCGAGAATTGATCAACTCAACGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-2499s1c1
Sequence:CCGGCCCAGAGATGAGAAACTAAATCTCGAGATTTAGTTTCTCATCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-1419s1c1
Sequence:CCGGCGGCCCACTTTGACTGATATACTCGAGTATATCAGTCAAAGTGGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-677s1c1
Sequence:CCGGCGAAACAACTAGAGGAAAGAACTCGAGTTCTTTCCTCTAGTTGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-2217s1c1
Sequence:CCGGCGTATCAATGAATATGCCTTACTCGAGTAAGGCATATTCATTGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-2748s1c1
Sequence:CCGGGCTCTTCAACTGCAAGTATTACTCGAGTAATACTTGCAGTTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007351.2-2994s21c1
Sequence:CCGGACTCAAGCTGCCCTATCTAATCTCGAGATTAGATAGGGCAGCTTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007351
MMRN1 MISSION shRNA shRNA Plasmid DNA
multimerin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007351.2-836s21c1
Sequence:CCGGTGTCTATAGGATGCAACATAACTCGAGTTATGTTGCATCCTATAGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007351.2-2342s21c1
Sequence:CCGGTAATAGTGAGATCCATCATAACTCGAGTTATGATGGATCTCACTATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007351.2-4231s21c1
Sequence:CCGGTTTACGTTGAGTTGATCAATTCTCGAGAATTGATCAACTCAACGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-2499s1c1
Sequence:CCGGCCCAGAGATGAGAAACTAAATCTCGAGATTTAGTTTCTCATCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-1419s1c1
Sequence:CCGGCGGCCCACTTTGACTGATATACTCGAGTATATCAGTCAAAGTGGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-677s1c1
Sequence:CCGGCGAAACAACTAGAGGAAAGAACTCGAGTTCTTTCCTCTAGTTGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-2217s1c1
Sequence:CCGGCGTATCAATGAATATGCCTTACTCGAGTAAGGCATATTCATTGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-2748s1c1
Sequence:CCGGGCTCTTCAACTGCAAGTATTACTCGAGTAATACTTGCAGTTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007351.2-2994s21c1
Sequence:CCGGACTCAAGCTGCCCTATCTAATCTCGAGATTAGATAGGGCAGCTTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007351
MMRN1 MISSION shRNA Lentiviral Transduction Particles
multimerin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007351.2-836s21c1
Sequence:CCGGTGTCTATAGGATGCAACATAACTCGAGTTATGTTGCATCCTATAGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007351.2-2342s21c1
Sequence:CCGGTAATAGTGAGATCCATCATAACTCGAGTTATGATGGATCTCACTATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007351.2-4231s21c1
Sequence:CCGGTTTACGTTGAGTTGATCAATTCTCGAGAATTGATCAACTCAACGTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-2499s1c1
Sequence:CCGGCCCAGAGATGAGAAACTAAATCTCGAGATTTAGTTTCTCATCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-1419s1c1
Sequence:CCGGCGGCCCACTTTGACTGATATACTCGAGTATATCAGTCAAAGTGGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-677s1c1
Sequence:CCGGCGAAACAACTAGAGGAAAGAACTCGAGTTCTTTCCTCTAGTTGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-2217s1c1
Sequence:CCGGCGTATCAATGAATATGCCTTACTCGAGTAAGGCATATTCATTGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007351.2-2748s1c1
Sequence:CCGGGCTCTTCAACTGCAAGTATTACTCGAGTAATACTTGCAGTTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007351.2-2994s21c1
Sequence:CCGGACTCAAGCTGCCCTATCTAATCTCGAGATTAGATAGGGCAGCTTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027613
MMRN1 MISSION shRNA Bacterial Glycerol Stock
multimerin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-636s21c1
Sequence:CCGGTTGCTAATGCCACGTTGAAATCTCGAGATTTCAACGTGGCATTAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027613.1-3948s21c1
Sequence:CCGGCATCAGCTCTGTTGTACTATTCTCGAGAATAGTACAACAGAGCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-2870s21c1
Sequence:CCGGCTTCAGCTGAAGGTACTAAATCTCGAGATTTAGTACCTTCAGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-3275s21c1
Sequence:CCGGAGGAACACAGACACCATTATACTCGAGTATAATGGTGTCTGTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-2626s21c1
Sequence:CCGGTGAGAAACTAAACCAGTTAAACTCGAGTTTAACTGGTTTAGTTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027613
MMRN1 MISSION shRNA shRNA Plasmid DNA
multimerin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-636s21c1
Sequence:CCGGTTGCTAATGCCACGTTGAAATCTCGAGATTTCAACGTGGCATTAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027613.1-3948s21c1
Sequence:CCGGCATCAGCTCTGTTGTACTATTCTCGAGAATAGTACAACAGAGCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-2870s21c1
Sequence:CCGGCTTCAGCTGAAGGTACTAAATCTCGAGATTTAGTACCTTCAGCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-3275s21c1
Sequence:CCGGAGGAACACAGACACCATTATACTCGAGTATAATGGTGTCTGTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-2626s21c1
Sequence:CCGGTGAGAAACTAAACCAGTTAAACTCGAGTTTAACTGGTTTAGTTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027613
MMRN1 MISSION shRNA Lentiviral Transduction Particles
multimerin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-636s21c1
Sequence:CCGGTTGCTAATGCCACGTTGAAATCTCGAGATTTCAACGTGGCATTAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027613.1-3948s21c1
Sequence:CCGGCATCAGCTCTGTTGTACTATTCTCGAGAATAGTACAACAGAGCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-2870s21c1
Sequence:CCGGCTTCAGCTGAAGGTACTAAATCTCGAGATTTAGTACCTTCAGCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-3275s21c1
Sequence:CCGGAGGAACACAGACACCATTATACTCGAGTATAATGGTGTCTGTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027613.1-2626s21c1
Sequence:CCGGTGAGAAACTAAACCAGTTAAACTCGAGTTTAACTGGTTTAGTTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)